pRDA_256 (Addgene #158581): U6 promoter expresses customizable guide RNA with a 10x guide capture sequence at the 3′ end of tracrRNA to facilitate future use with direct capture, single-cell RNA sequencing; core EF1a (EFS) expresses codon-optimized BE3 with 2xSV40NLS and 2A site provides puromycin resistance.25 (link)pIR-CMV-SCN2A-Variant-1-IRES-mScarlet (Addgene #162279): Eukaryotic expression of human SCN2A variant 1 isoform, stabilized with IRES intron and with a mScarlet marker for visual confirmation of plasmid expression in cell culture.36 (link)
Mscarlet
Manufactured by Addgene
MScarlet is a genetically-encoded fluorescent protein that emits red fluorescence. It is derived from the mScarlet-I variant and has an excitation peak at 569 nm and an emission peak at 594 nm.
Automatically generated - may contain errors
Lab products found in correlation
Prda 256, by Addgene (1 mentions)
Sodium bicarbonate, by Merck Group (1 mentions)
Ni nta agarose resin, by Qiagen (1 mentions)
Glutaraldehyde, by Merck Group (1 mentions)
Low melting point agarose, by Thermo Fisher Scientific (1 mentions)
Neutravidin, by Thermo Fisher Scientific (1 mentions)
Luria bertani broth, by BD (1 mentions)
Tryptone, by BD (1 mentions)
Sodium chloride (nacl), by Duksan Pure Chemicals (1 mentions)
Glacial acetic acid, by Duksan Pure Chemicals (1 mentions)
Disposable column empty gravity column, by Qiagen (1 mentions)
Ethylene diamine tetraacetic acid (edta), by Duksan Pure Chemicals (1 mentions)
Peg succinimidyl valerate, by Laysan Bio (1 mentions)
Biotin peg succinimidyl carbonate, by Laysan Bio (1 mentions)
Minisog2, by Addgene (1 mentions)
Neon transfection system, by Thermo Fisher Scientific (1 mentions)
6 protocols using mscarlet
1
Customizable CRISPR-Cas9 and SCN2A expression
2
DNA Primer and Protein Plasmid Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA primers and oligonucleotides were purchased from COSMOGENETH (Seoul, Korea). The fluorescent protein plasmid for mScarlet was purchased from Addgene (Watertown, MA). Neutravidin was purchased from ThermoFischer Scientific (Waltham, MA). Enzymes and λ DNA (48.5 kb) were purchased from New England Biolabs (Ipswich, MA). Tryptone and Luria-Bertani broth (LB) were purchased from Becton, Dickinson and Company (Franklin Lakes, NJ). Low melting point (LMP) agarose was purchased from Invitrogen (Carlsbad, CA), and agarose was from Young Sciences, Inc. (Bucheon, Korea). Epoxy was from Permatex (Solon, OH). N-[3-(Trimethoxysilyl)propyl]ethylenediamine was purchased from Acros organics (Fair Town, NJ). Ni-NTA agarose resin and disposable column (empty gravity column) were purchased from Qiagen (Hilden, Germany). Biotin-PEG-succinimidyl carbonate and PEG-succinimidyl valerate were purchased from Laysan Bio Inc (Arab, AL). Sodium chloride, EDTA, and glacial acetic acid were purchased from Duksan (Ansan, Korea). H2O2, H2SO4 and 99.8% ethanol were purchased from JIN Chemical (Hwaseong, Korea). n-Dodecyl-β-d -maltopyranoside (DDM) were purchased from Goldbio (St. Louis, MO). N-Octyl-β-maltopyranoside (OM) were purchased from Anatrace (Maumee, OH). Glutaraldehyde, sodium bicarbonate, thiamine HCl, and other chemicals were purchased from Merck (Darmstadt, Germany).
3
Transgenic Zebrafish Lines for Neural Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Tg(elavl3:sypb-miniSOG2-P2A-mScarlet) line was generated by Tol2 transgenesis of a 8.7 kb elavl3 promoter (Addgene: 59531, AgeI restriction enzyme digested) driving expression of sypb (Addgene: 74316), miniSOG2 (Addgene: 87410), P2A-mScarlet (gift from A. Beisaw) cloned with Cold Fusion (System Biosciences). The Tg(ins:mCardinal) line was generated by Tol2 transgenesis of a 1.1 kb ins promoter (in-house plasmid, MluI restriction enzyme digested) driving expression of mCardinal (Addgene: 51311) cloned with Cold Fusion.
4
Endogenous E-cadherin Tagging in MDCK Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To tag the endogenous E-cadherin gene (cdh1) from MDCK cells we followed the protocol described by Bollen and collaborators (Bollen et al., 2022 (link)). The gRNA used was “GAGGTGGCGAGGACGACTAG” which targets the region between D882 and the STOP Codon at the C-terminal portion of E-cadherin. This gRNA was cloned into a Cas9 D10A backbone (PX462) (Addgene 62987). The upstream and downstream homology arms, both 500 bp, were cloned into the plasmid TVBB C-term-mScarlet (Addgene 169219) with the purpose of knocking in mScarlet in frame with D882. Both constructs were then electroporated into MDCK cells using the Neon™ transfection system (Thermo Fisher) and single cell clones isolated by serial dilution and checked for the fluorescent phenotype.
5
Fluorescent Protein Tagging of GABA Receptor Subunits
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TAX-4 was a gift from Drs. Jonathan Pierce and Iku Mori. EGFP was appended to the N-terminus of TAX-4 (GFP-TAX-4) in the pUNIV vector as follows: A previous construct with an N-terminal EGFP in pUNIV containing an ApaI restriction site between EGFP and the gene and an MluI restriction site following the gene was used as a starting template. The previous gene was excised between ApaI and MluI sites, and TAX-4 was inserted using the same sites. This resulted in a two-residue linker (G-P) between EGFP and TAX-4. The entire gene was sequenced for verification.
The full-length rat GABAA receptor α1, β2, and γ2L subunits in the pUNIV vector were a gift from Dr. Cynthia Czajkowski. mScarlet (Addgene #99280) was inserted in the M3-M4 loop of the α1 subunit between residues V372 and K373 using an in-frame non-native Asc1 restriction site (GGGCGCGCC) introduced through site-directed mutagenesis as previously described60 (link). This results in the insertion of an additional three residues (G-R-A) on each end of mScarlet. EGFP was similarly inserted in the N terminal region of the β2 subunit between residues N4 and D5, again using an in-frame non-native Asc1 restriction site as described for mScarlet.
The full-length rat GABAA receptor α1, β2, and γ2L subunits in the pUNIV vector were a gift from Dr. Cynthia Czajkowski. mScarlet (Addgene #99280) was inserted in the M3-M4 loop of the α1 subunit between residues V372 and K373 using an in-frame non-native Asc1 restriction site (GGGCGCGCC) introduced through site-directed mutagenesis as previously described60 (link). This results in the insertion of an additional three residues (G-R-A) on each end of mScarlet. EGFP was similarly inserted in the N terminal region of the β2 subunit between residues N4 and D5, again using an in-frame non-native Asc1 restriction site as described for mScarlet.
6
Fluorescent Protein-Tagged GABA Receptor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TAX-4 was a gift from Drs. Jonathan Pierce and Iku Mori. EGFP was appended to the Nterminus of TAX-4 (GFP-TAX-4) in the pUNIV vector as follows: A previous construct with an N-terminal EGFP in pUNIV containing an ApaI restriction site between EGFP and the gene and an MluI restriction site following the gene was used as a starting template. The previous gene was excised between ApaI and MluI sites, and TAX-4 was inserted using the same sites. This resulted in a two-residue linker (G-P) between EGFP and TAX-4. The entire gene was sequenced for verification.
The full-length rat GABAA receptor α1, β2 and γ2L subunits in the pUNIV vector were a gift from Dr. Cynthia Czajkowski. mScarlet (Addgene #99280) was inserted in the M3-M4 loop of the α1 subunit between residues V372 and K373 using an in-frame non-native Asc1 restriction site (GGGCGCGCC) introduced through site-directed mutagenesis as previously described 60 . This results in the insertion of an additional three residues (G-R-A) on each end of mScarlet. EGFP was similarly inserted in the N terminal region of the β2 subunit between residues N4 and D5, again using an in-frame non-native Asc1 restriction site as described for mScarlet.
The full-length rat GABAA receptor α1, β2 and γ2L subunits in the pUNIV vector were a gift from Dr. Cynthia Czajkowski. mScarlet (Addgene #99280) was inserted in the M3-M4 loop of the α1 subunit between residues V372 and K373 using an in-frame non-native Asc1 restriction site (GGGCGCGCC) introduced through site-directed mutagenesis as previously described 60 . This results in the insertion of an additional three residues (G-R-A) on each end of mScarlet. EGFP was similarly inserted in the N terminal region of the β2 subunit between residues N4 and D5, again using an in-frame non-native Asc1 restriction site as described for mScarlet.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!