Prime script reagent rt kit

Manufactured by Takara Bio

Sourced in China

The PrimeScript RT reagent Kit is a reverse transcription reagent set designed for the conversion of RNA to cDNA. The kit includes necessary components for this process, such as the PrimeScript Reverse Transcriptase enzyme and appropriate buffers.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (6 mentions) Abi prism 7900ht real time system, by Thermo Fisher Scientific (3 mentions) Abi 7900 prism ht, by Thermo Fisher Scientific (1 mentions) C myc, by Takara Bio (1 mentions) C myc, by Thermo Fisher Scientific (1 mentions) Sybr green pcr, by Takara Bio (1 mentions) Sybr prime script rt pcr kits, by Takara Bio (1 mentions) 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)

7 protocols using prime script reagent rt kit

Quantitative Real-Time PCR Analysis of Inflammatory Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA from the brain tissue or cells was extracted and reversed transcribed using TRIzol Reagent (Invitrogen) and a Prime Script reagent RT Kit (Takara Biotechnology) according to the manufacturer's protocol. Real‐time qPCR was performed using an ABI Prism 7900HT Real‐Time System (Applied Biosystems Inc). The following primers were used: IL‐1β, AAATCTCGCAGCAGCACAT (forward) and CACACACCAGCAGGTTATCA (reverse); Cxcl‐1, CTGGGATTCACCTCAAGAACATC (forward) and CAGGGTCAAGGCAAGCCTC (reverse); Cxcl‐2, CCAACCACCAGGCTACAGG (forward) and GCGTCACACTCAAGCTCTG (reverse); TIM‐4, ACACATTTTCCCTGCCTCGT (forward) and GCTGTGGCAAGGATTTCACC(reverse); IL‐6, CCACTTCACAAGTCGGAGGCTTA (forward) and CCAGTTTGGTAGCATCCATCATTTC (reverse); TNF, TATGGCCCAGACCCTCACA (forward) and GGAGTAGACAAGGTACAACCCATC (reverse); and Actin, GACATGGAGAAGATCTGGCACCACA (forward) and ATCTCCTGCTCGAAGTCTAGAGCAA (reverse).
Actin was used as a housekeeping gene. The results were presented as the ratio of the gene to the expression of actin mRNA (sense and antisense).

Zheng L., Huang Y., Wang X., Wang X., Chen W., Cheng W, & Pan C. (2019). Inhibition of TIM‐4 protects against cerebral ischaemia‐reperfusion injury. Journal of Cellular and Molecular Medicine, 24(2), 1276-1285.

+ Open protocol

+ Expand

Evaluating MDR1 Expression in Drug-Treated Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were treated with DMSO, OSI-027 (double the IC₅₀ concentrations), doxorubicin (IC₅₀ concentrations), or OSI-027 plus doxorubicin for 24 hours, and total RNA was extracted using TRIzol Reagent (Invitrogen) and reverse transcribed using the Prime Script reagent RT Kit (Takara Biotechnology). Primers for MDR1 were designed and purchased from Takara. PCR was performed on an ABI Prism 7900HT Real-Time System (Applied Biosystems Inc). MDR1 mRNA expression was normalized to β-actin and determined using the comparative 2^−ΔΔCt method (27 (link)). Detailed sequences of primers for MDR1 and β-actin are given in the Supplementary Materials and Methods.

Chen B.W., Chen W., Liang H., Liu H., Liang C., Zhi X., Hu L.Q., Yu X.Z., Wei T., Ma T., Xue F., Zheng L., Zhao B., Feng X.H., Bai X.L, & Liang T.B. (2015). Inhibition of mTORC2 Induces Cell-Cycle Arrest and Enhances the Cytotoxicity of Doxorubicin by Suppressing MDR1 Expression in HCC Cells. Molecular cancer therapeutics, 14(8), 1805-1815.

+ Open protocol

+ Expand

Profiling Oncogene Expression in Liver Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from HuH-7, HepG2, SNU-449 and SNU-387 cells treated for 48 h using Trizol Reagent (Invitrogen; Carlsbad, CA, USA), and then reverse transcribed using Prime Script Reagent RT Kit (Takara Biotechnology Co.; Dalian, China) following the manufacturer's protocol. The PCR-primers for FOXO3a, ZEB1, CyclinD1 and v-myc avian myelocytomatosis viral oncogene homolog (c-Myc) were designed and purchased from Takara. The sequences are as follows:

FOXO3a: (forward: 5-TGCGTGCCCTACTTCAAGGATAA-3; reverse: 5-ACAGGTTGTGCCGGATGGA-3)

ZEB1: (forward: 5-CTTGAACGTCACATGACATCACATA-3; reverse: 5-TCTTGCAGTTTGGGCATTCATA-3)

CyclinD1: (forward: 5-TACCGCACAACGCACTTTC-3; reverse: 5-AAGGGCTTCAATCTGTTCCTG-3),

c-Myc: (forward: 5-GCAGCTGCTTAGACGCTGGA-3; reverse: 5-CGCAGTAGAAATACGGCTGCAC-3).

RT-PCR was performed using ABI 7900 Prism HT (Applied Biosystems Inc.; Shanghai, China) followed by melting curve analysis. FOXO3a, ZEB1, CyclinD1 and c-Myc mRNA expression was normalized to β-actin (forward: 5-TGGCACCCAGCACAATGAA-3; reverse: 5-CTAAGTCATAGTCCGCCTAGAAGCA-3).

Zhou Y., Liang C., Xue F., Chen W., Zhi X., Feng X., Bai X, & Liang T. (2015). Salinomycin decreases doxorubicin resistance in hepatocellular carcinoma cells by inhibiting the β-catenin/TCF complex association via FOXO3a activation. Oncotarget, 6(12), 10350-10365.

+ Open protocol

+ Expand

Quantifying eIF-5A-2 mRNA Expression in Liver Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from Hep3B, Huh7, SNU387 and SUN449 cells using TRIzol reagent (Invitrogen; Carlsbad, CA, USA) and reverse transcribed into cDNA using Prime Script reagent RT kit (Takara Biotechnology, Co., Ltd., Dalian, China) and the following thermocycling conditions: 42°C for 2 min, 15 min at 37°C and 5 sec at 85°C. Expression of eIF-5A-2 mRNA was normalized to U6 and relative quantification was performed using the comparative 2^−ΔΔCt method (31 (link)). SYBR Green PCR (Takara Biotechnology, Co., Ltd., Dalian, China) was performed at 95°C for 30 sec, followed by 40 cycles of denaturation at 95°C for 5 sec and annealing at 60°C for 30 sec. All reactions were performed in triplicate. The primers were as follows: eIF-5A-2 forward, 5′-TATGCAGTGCTCGGCCTTG-3′, and reverse, 5′-TTGGAACATCCATGTTGTGAGTAGA-3′; and miR-9, 5′-TCTTTGGTTATCTAGCTGTATGA-3′. Negative control: Sense, 5′-UUCUCCGAACGUGUCACGUTT-3′ and antisense, 5′-ACGUGACACGUUCGGAGAATT-3′.

Xue F., Liang Y., Li Z., Liu Y., Zhang H., Wen Y., Yan L., Tang Q., Xiao E, & Zhang D. (2017). MicroRNA-9 enhances sensitivity to cetuximab in epithelial phenotype hepatocellular carcinoma cells through regulation of the eukaryotic translation initiation factor 5A-2. Oncology Letters, 15(1), 813-820.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted from the tissues or cultured cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. The quality and integrity of acquired RNA was evaluated by Nanodrop2000c and gel electrophoresis, respectively. RT-qPCR was performed with Prime Script reagent RT Kit and SYBR Prime Script RT-PCR Kits (Takara, Dalian, China) based on the manufacturer’s instructions. All real-time PCR reactions were performed using a 7500 Fast Real Time PCR System (Applied Biosystems). The target gene expression level was calculated with the 2^−ΔΔCt method, which was normalized to β-catin mRNA. The relative fold changes were calculated using the 2^-ΔΔCt method with their corresponding inner control genes. The primers used in this study were shown in Table 2.

Zhou B., Guo W., Sun C., Zhang B, & Zheng F. (2018). Linc00462 promotes pancreatic cancer invasiveness through the miR-665/TGFBR1-TGFBR2/SMAD2/3 pathway. Cell Death & Disease, 9(6), 706.

+ Open protocol

+ Expand

Hypoxia Regulates Beclin-1 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

The luciferase reporter constructs driven by FOXO3a binding element of beclin-1 promotor or its mutant form (GenePharma) were transfected into LM-3 cells. Then, transfected LM-3 cells were incubated in normoxia or in hypoxia for 48 h, the RNA was isolated and reverse transcribed using Prime Script Reagent RT Kit (Takara, Dalian, China) following the manufacturer’s instructions. The quantification of luciferase mRNA was exerted by RT-PCR using luciferase primers.

Liang C., Dong Z., Cai X., Shen J., Xu Y., Zhang M., Li H., Yu W, & Chen W. (2020). Hypoxia induces sorafenib resistance mediated by autophagy via activating FOXO3a in hepatocellular carcinoma. Cell Death & Disease, 11(11), 1017.

+ Open protocol

+ Expand

Quantifying MDR1 Expression in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were treated with vehicle or OSI-027 (Panc-1, BxPC-3 and CFPAC-1: 10 and 20 μM) for 24 hours or interfered using MDR1 siRNA as described in section 5. Total RNA was extracted and reverse transcribed using TRIzol Reagents (Invitrogen, Shanghai, China) and Prime Script reagent RT Kit (Takara Biotechnology, Dalian, China) according to the manufacturer's protocol. Primers for MDR1 were designed and obtained from Takara (forward, 5′-TGACTCAGGAGCAGAAGTTTGAACA-3′; reverse, 5′-AAATACATCATTGCCTGGGTGAAG-3′). Real-time qPCR was performed on the ABI Prism 7900HT Real-Time System (Applied Biosystems Inc, Shanghai, People's Republic of China), and MDR1 mRNA expression level was normalized to that of β-actin (forward, 5′-TGGCACCCAGCACAATGAA-3′; reverse, 5′-CTAAGTCATAGTCCGCCTAGAAGCA-3′).

Zhi X., Chen W., Xue F., Liang C., Chen B.W., Zhou Y., Wen L., Hu L., Shen J., Bai X, & Liang T. (2015). OSI-027 inhibits pancreatic ductal adenocarcinoma cell proliferation and enhances the therapeutic effect of gemcitabine both in vitro and in vivo. Oncotarget, 6(28), 26230-26241.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!