Briefly, DN cells were isolated from Bl.6 Rag2−/− mice and cross-linked with 1% formaldehyde. Histone ChIPs were performed by using cross-linked nuclear extracts from 5 million cells with 2 μg specific antibodies and 20 μl Dynabeads Protein G suspension (Life Technologies, USA), whereas 50 million cells were used for Pol II ChIPs. Antibodies used are described in Koch et al., with the exception of H3K27ac (ab4729; Abcam). DNA was extracted from immunoprecipitated chromatin and was used to prepare sequencing library using TrueSeq ChIP-seq Library Preparation Kit (Illumina Inc., USA) according to manufacturer's instructions, and sequenced on a Genome Analyzer II sequencing platform (Illumina Inc., USA). Data processing, including input subtraction and wig files generation was performed as previously described43 (link).
Genome analyzer 2 sequencing platform
Manufactured by Illumina
Sourced in United States
The Genome Analyzer II is a next-generation sequencing platform designed for high-throughput DNA sequencing. It utilizes reversible terminator-based sequencing technology to generate high-quality sequence data. The platform is capable of producing large volumes of sequence data, making it a valuable tool for various genomic research applications.
Automatically generated - may contain errors
5 protocols using genome analyzer 2 sequencing platform
1
Histone ChIP-seq in DN cells
2
Small RNA Sequencing from Rag2-/- Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from DN cells isolated from Rag2−/− cells using TriZol Reagent (Life Technologies, USA). Total RNA of 10 μg was fractionated by TBE-Urea PAGE to isolate RNA fragments ranging from 15 nucleotides to 70 nucleotides length. These size-selected small RNAs were used to prepare sequencing library using Small RNA-Seq Library Preparation Kit (Illumina Inc., USA) according to manufacturer's instructions. Libraries were then sequenced on a Genome Analyzer II sequencing platform (Illumina Inc., USA). The RNA-Seq data used is accessible in gene omnibus under the accession number GSE44578.
3
16S rRNA Gene Amplification and Sequencing
4
16S rRNA Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA samples were prepared as previously described (66 (link)) with the following modifications. Universal primers F515 (5′-NNNNNNNNGT GTGCCAGCMGCCGCGGTAA-3′) and R806 (5′-GGACTACHVGGGTWTCTAAT -3′), with the forward primer modified to contain an 8-nucleotide (nt) barcode [italicized poly(N) section of the primer above] and 2-nt linker sequence (boldface portion) at the 5′ end, were used to amplify the V4 region of the 16S rRNA gene. PCR mixtures contained 5.0 μl of 2 × GoTaq Green Master Mix (Promega, Madison, WI), 0.4 μl of 25 mM MgCl2, 2.4 μl of water, 0.2 μl of reverse primer (10 mM final concentration), 1.0 μl of forward primer (2 mM final concentration), and 1.0 μl of genomic DNA. Reactions were held at 94°C for 3 min to denature the DNA, with amplification proceeding for 25 cycles, with 1 cycle consisting of 94°C for 45 s, 50°C for 60 s, and 72°C for 90 s; a final extension of 10 min at 72°C was included to ensure complete amplification. The PCR products were purified using QIAquick PCR purification kit (catalog no. 28106; Qiagen, Valencia, CA). A sequencing library was created by combining equimolar ratios of amplicons from individual samples. The composite sample was sequenced at the DNA Technologies Core Facility of the University of California, Davis, on an Illumina Genome Analyzer II sequencing platform.
5
16S rRNA Gene Amplicon Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were prepared for sequencing
as previously described26 (link) with some variations.
The V4 region of the 16S rRNA gene was PCR amplified using universal
barcoded primers with Illumina sequencing adapters, shown in italics,
the N represents the 8 bp barcode sequence unique to each sample,
and the linker is in bold, V4F (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNGT GTGCCAGCMGCCGCGGTAA-3′)
and V4Rev (5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTCC GGACTACHVGGGTWTCTAAT-3′).
PCR reactions contained 12.5 μL of 2× GoTaq Green Master
Mix (Promega, Madison, WI), 1.0 μL of 25 mM MgCl2, 8.5 μL of water, 0.5 μL of forward and reverse primers
(10 μM final concentration), and 2.0 μL of genomic DNA.
PCR amplification was carried out in triplicate with conditions as
previously described.26 (link) Amplicons were
combined and cleaned using the QIAquick 96 PCR Purification Kit (Qiagen,
Valencia, CA). Amplicon DNA concentrations were quantified using the
Quant-iT PicoGreen dsDNA Kit in 96-well microplates, and fluorescence
detection, composite sample mixture, and gel purification were carried
out as previously described.26 (link) The sample
was sent to the University of California DNA Technologies Core Facility
for sequencing on an Illumina Genome Analyzer II sequencing platform.
as previously described26 (link) with some variations.
The V4 region of the 16S rRNA gene was PCR amplified using universal
barcoded primers with Illumina sequencing adapters, shown in italics,
the N represents the 8 bp barcode sequence unique to each sample,
and the linker is in bold, V4F (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNN
and V4Rev (5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
PCR reactions contained 12.5 μL of 2× GoTaq Green Master
Mix (Promega, Madison, WI), 1.0 μL of 25 mM MgCl2, 8.5 μL of water, 0.5 μL of forward and reverse primers
(10 μM final concentration), and 2.0 μL of genomic DNA.
PCR amplification was carried out in triplicate with conditions as
previously described.26 (link) Amplicons were
combined and cleaned using the QIAquick 96 PCR Purification Kit (Qiagen,
Valencia, CA). Amplicon DNA concentrations were quantified using the
Quant-iT PicoGreen dsDNA Kit in 96-well microplates, and fluorescence
detection, composite sample mixture, and gel purification were carried
out as previously described.26 (link) The sample
was sent to the University of California DNA Technologies Core Facility
for sequencing on an Illumina Genome Analyzer II sequencing platform.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!