Small pieces in selected concentrations of berberine were fixed in 2.5% glutaraldehyde and 2% paraformaldehyde in 0.1 M sodium-phosphate buffer (pH 7.3) for 12 h at 4 °C. After washing in buffer, the skin pieces were postfixed in 1% OsO4 for 1 h at 4 °C. The samples were dehydrated in an ascending grade of acetone, and then infiltrated and embedded in araldite CY 212 (TAAB, West Berkshire, UK). Thick sections (1 μm) were cut with an ultramicrotome, mounted onto glass slides, stained with aqueous toluidine blue, and observed under a light microscope for gross observation of the area and quality of the tissue fixation. For the electron-microscope examination, thin sections of gray–silver color interference (70–80 nm) were cut and mounted onto 300-mesh copper grids. The sections were stained with alcoholic uranyl acetate and alkaline lead citrate, washed gently with distilled water, and observed under a Morgagni 268D transmission electron microscope (FEI Company, Eindhoven, The Netherlands) at an operating voltage of 80 kV. Images were digitally acquired by using a charge-coupled-device camera (MegaView III; FEI Company) attached to the microscope. TEM was done at All India Institute of Medical Science, New Delhi, India.
Megaview 3
Manufactured by Thermo Fisher Scientific
Sourced in Japan
The Megaview III is a high-performance digital camera system designed for advanced microscopy applications. It features a large, high-resolution sensor and provides exceptional image quality for a variety of imaging techniques.
Automatically generated - may contain errors
Lab products found in correlation
Araldite cy 212, by TAAB (2 mentions)
Morgagni 268d transmission electron microscope, by Thermo Fisher Scientific (2 mentions)
Primescript rt kit, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Cfx connect, by Bio-Rad (2 mentions)
Evo 18, by Zeiss (1 mentions)
Glutaraldehyde, by Agar Scientific (1 mentions)
Tecnai g2 electron microscope, by Thermo Fisher Scientific (1 mentions)
Analysis version docu software, by Olympus (1 mentions)
Metal enhanced dab substrate kit, by Thermo Fisher Scientific (1 mentions)
Cm12 microscope, by Thermo Fisher Scientific (1 mentions)
7 protocols using megaview 3
1
Ultrastructural Analysis of Skin Tissue
2
Ultrastructural Changes in T. roseum Conidia Exposed to Cuminal
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One-hour-old PDB culture of T. roseum conidia was exposed to 4 µL/mL of cuminal while the control was without cuminal, and further cultured for 1 day. The fungal cells were harvested, and washed thrice with sterile 0.85% saline. The morphological and ultrastructural changes were observed under scanning electron microscopy (SEM) (Evo-18, Zeiss) and transmission electron microscopy (TEM) (Tecnai G2-T20 STwin 200kV, Fei Co.), respectively, after sample preparation was done according to the method of Dwivedy et al. [30 (link)]. Digital images were acquired with a charge-coupled device camera (Megaview III, Fei Company, Eindhoven, The Netherlands) using the microscope-attached software iTEM (Sift Imaging System, Münster, Germany).
3
Ultrastructural Visualization of Tf-HRP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Infected HeLa cells were washed with PBS (3×) and cooled on ice before fixation with 0.5% glutaraldehyde (Agar Scientific) in 200 mM sodium cacodylate (TAAB) for 5 min on ice, then at RT for a further 25 min. Cells were immediately washed in cacodylate buffer and Tf-HRP reacted with diaminobenzidine (DAB) in stable peroxide buffer (Metal Enhanced DAB Substrate Kit, Thermo Scientific) for 30 min at RT. The reaction was stopped by washing in sodium cacodylate before post-fixation in 1% osmium tetroxide/1.5% potassium ferrocyanide for 1 h at RT. The cells were then washed in ddH2O, stained overnight at 4°C with 0.5% uranyl acetate, washed with ddH2O and serially dehydrated in graded ethanol before infiltration with Epon 812 resin. Ultrathin sections (∼70 nm) of the flat-embedded cell monolayers were cut parallel to the surface of the dish, collected onto formvar-coated 50 mesh EM grids, and stained for 30 s with Reynolds' lead citrate before imaging. TEM samples were viewed by using an FEI Tecnai G2 electron microscope with a Soft Imaging System Megaview III charged-coupled-device camera. Images were collected at 1376 by 1032 by 16 pixels using AnalySIS version Docu software (Olympus Soft Imaging Solutions).
4
Carbon-Coated Polymer Film Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The polymer films were first coated with an amorphous carbon film of a few nm thickness under high vacuum (Edwards Auto 306 evaporator). Then, the carbon-coated films were lifted from the substrate using an aqueous solution of HF (5% in weight) and recovered on TEM copper grids. The samples were analyzed with a FEI CM12 microscope (120 kV) equipped with a Megaview III camera under low dose conditions in bright field and diffraction modes.
5
Ultrastructural Analysis of WJ-MSCs and Neurospheres
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WJ-MSCs and neurospheres generated from this cells were fixed in Karnovsky's fixative buffer (2.5% glutaraldehyde and 2% paraformaldehyde in 0.1 M Phosphate buffer, pH 7.2) overnight at 4°C. Subsequently, the WJ-MSCs and WJ-MSCs primed neurospheres were washed in 0.1 M phosphate buffer and fixed in 1% OsO4 for 1 h at 4°C followed by dehydration in an ascending grade of acetone. After dehydration, cells were infiltrated and embedded in Araldite CY 212 (TAAB, UK). Thick sections (1 μm) were cut with an ultramicrotome, mounted on glass slides, and stained with aqueous toluidine blue. The sections were observed under a light microscope for gross observation of the area and quality of the tissue fixation. For electron microscopic examination, thin sections of grey-silver color interference (70-80 nm) were cut and mounted onto 300 mesh copper grids. They were stained using alcoholic uranyl acetate and alkaline lead citrate. After a gentle wash in distilled water, they were observed under a Morgagni 268D transmission electron microscope (FEI Company, The Netherlands). Images were digitally acquired at an operating voltage 80 kV by using a CCD camera (Megaview III, FEI Company) attached to the microscope at Sophisticated Analytical Instrument Facility, AIIMS, New Delhi.
6
Mitochondrial Ultrastructure and PTGS2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the measurement of mitochondrial structural changes, the electron microscopy method was used in HT-22 cells. After paraformaldehyde xation, cells were processed and sectioned with a diamond knife on copper grids. Grids were examined with a Hitachi (Tokyo, Japan) electron microscope, and pictures were captured using a MegaView III digital camera.
qRT-PCR (Quantitative-real-time PCR)
Total RNA from HT22 cells was isolated by TRIzol (Invitrogen, US) according to product instructions. After RNA isolation, the PrimeScript RT kit (#RR037, Takara, Japan) was used to reverse-transcribe RNA into cDNA according to the product speci cation. Quantitative real-time PCR was performed using the twostep RT-PCR method by CFX connect (Bio-Rad, US). The sequences of Primers for RT-PCR of PTGS2 are TGCACTATGGTTACAAAAGCTGG (Forward Primer), TCAGGAAGCTCCTTATTTC CCTT (Reverse Primer).
qRT-PCR (Quantitative-real-time PCR)
Total RNA from HT22 cells was isolated by TRIzol (Invitrogen, US) according to product instructions. After RNA isolation, the PrimeScript RT kit (#RR037, Takara, Japan) was used to reverse-transcribe RNA into cDNA according to the product speci cation. Quantitative real-time PCR was performed using the twostep RT-PCR method by CFX connect (Bio-Rad, US). The sequences of Primers for RT-PCR of PTGS2 are TGCACTATGGTTACAAAAGCTGG (Forward Primer), TCAGGAAGCTCCTTATTTC CCTT (Reverse Primer).
7
Mitochondrial Ultrastructure and PTGS2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the measurement of mitochondrial structural changes, the electron microscopy method was used in HT-22 cells. After paraformaldehyde xation, cells were processed and sectioned with a diamond knife on copper grids. Grids were examined with a Hitachi (Tokyo, Japan) electron microscope, and pictures were captured using a MegaView III digital camera.
qRT-PCR (Quantitative-real-time PCR)
Total RNA from HT22 cells was isolated by TRIzol (Invitrogen, US) according to product instructions. After RNA isolation, the PrimeScript RT kit (#RR037, Takara, Japan) was used to reverse-transcribe RNA into cDNA according to the product speci cation. Quantitative real-time PCR was performed using the twostep RT-PCR method by CFX connect (Bio-Rad, US). The sequences of Primers for RT-PCR of PTGS2 are TGCACTATGGTTACAAAAGCTGG (Forward Primer), TCAGGAAGCTCCTTATTTC CCTT (Reverse Primer).
qRT-PCR (Quantitative-real-time PCR)
Total RNA from HT22 cells was isolated by TRIzol (Invitrogen, US) according to product instructions. After RNA isolation, the PrimeScript RT kit (#RR037, Takara, Japan) was used to reverse-transcribe RNA into cDNA according to the product speci cation. Quantitative real-time PCR was performed using the twostep RT-PCR method by CFX connect (Bio-Rad, US). The sequences of Primers for RT-PCR of PTGS2 are TGCACTATGGTTACAAAAGCTGG (Forward Primer), TCAGGAAGCTCCTTATTTC CCTT (Reverse Primer).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!