The DNA sequence surrounding the variant was amplified using polymerase chain reaction (PCR, primer sequences and PCR conditions are available on request) and screened for mutations using BigDye terminator sequencing (BigDye Terminators (v 1.1) Applied Biosystems, Foster City, CA, USA). Analysis was performed on an ABI 3730 DNA Analyzer (Applied Biosystems). Subsequently, the data were analyzed using Vector NTI advance v11.0 (Invitrogen Corporations, Paisley, UK) or Chromas Lite (Technelysium, Australia). For mutation analysis of CDH1 exon 1 in a subset of the patients, primers surrounding the intron-exon boundaries of this exon were used. PCR and sequencing was performed as described for variant validation.
Bigdye terminators v 1.1
Manufactured by Thermo Fisher Scientific
Sourced in United States
BigDye Terminators (v 1.1) is a sequencing reagent kit designed for DNA sequencing. It contains the necessary components, including labeled dideoxynucleotides, to perform DNA sequencing reactions.
Automatically generated - may contain errors
3 protocols using bigdye terminators v 1.1
1
Variant Screening in CDH1 Gene
2
Molecular Typing of blaKPC Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the typing of the blaKPC gene, overlapping PCR reactions were performed using the following primer pairs: F-5′CGGAACCATTCGCTAAACTC3′ and R-3′GGCGGCGTTATCACTGTATT5′; F-5′CGCCGTGCAATACAGTGATA3′and R-3′CGTTGACGCCCAATCC5′ (Goldfarb et al. [31 (link)]). Amplification products were purified using the Montage PCR Centrifugal Filter Device (Millipore Corporation, Billerica, MA, USA), and sequencing was performed by Big Dye Terminators V1.1 (Applied Biosystems, Foster City, CA, USA) and migrated with an automated sequencer (ABI Prism 310; Applied Biosystems). Sequences were aligned and compared using the National Center for Biotechnology Information database (http://www.ncbi.nlm.nih.gov , 13 November 2021).
3
SARS-CoV-2 S Gene Deletion Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the presence of the deletions in the products obtained from our multiplex PCR assay, amplicons from a separate amplification of a large part of the S gene (containing all deletions) were sequenced by the Sanger method using either the sequencing service by Bio-Fab research (Bio-Fab research, Rome, Italy) or by in-house sequencing performed using BigDye Terminators V1.1 (Applied Biosystems, Foster City, CA, USA) and analyzed with ABI Prism 310 (Applied Biosystems). The following primers were used: S seq F 5′ CCA CTA GTC TCT AGT CAG TGT GT 3′ and S seq R 5′ GAG AGG GTC AAG TGC ACA GT 3′ (this work).
All methods described were carried out in accordance with relevant guidelines and regulations.
All methods described were carried out in accordance with relevant guidelines and regulations.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!