Ion pgmtm sequencing 400 kit

Manufactured by Thermo Fisher Scientific

The Ion PGM™ Sequencing 400 Kit is a laboratory instrument used for DNA sequencing. It provides a platform for high-throughput, massively parallel sequencing of DNA samples. The kit includes reagents and consumables required to perform the sequencing process.

Automatically generated - may contain errors

Lab products found in correlation

Ion 318 chip kit v2, by Thermo Fisher Scientific (1 mentions) Accuprime pcr buffer 2, by Thermo Fisher Scientific (1 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions) Accuprime taq dna polymerase high fidelity, by Thermo Fisher Scientific (1 mentions) Qiaamp fast dna stool kit, by Qiagen (1 mentions) Gel extraction kit, by Qiagen (1 mentions) Ion onetouch 2 system, by Thermo Fisher Scientific (1 mentions) Ion plus fragment library kit, by Thermo Fisher Scientific (1 mentions) Qubit 2.0 fluorometer, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

Ion PGM (71 citations) Ion PGM Sequencing 400 Kit (39 citations) Ion Sequencing 400 kit (6 citations)

4 protocols using ion pgmtm sequencing 400 kit

Comparative Microbial Analysis of Fermented Foods

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Equivalent amounts of each sample were added to the reaction mixture for sequencing and there was no replicate analysis for any sample. The libraries were sequenced in Ion PGM^TM using an Ion PGM^TM Sequencing 400 Kit and finally deposited into two Ion 318^TM chip Kits v2 according to the manufacturer's protocol (all kits and systems were provided by Life Technologies).
The data analyses were performed using QIIME¹⁰ (link) and USEARCH.¹¹ (link) First, raw data (reads) with low quality (maximum error probability of 0.5), smaller than 200 bp and considered chimaeras were eliminated. Then, samples were demultiplexed according to barcode sequence for OTU clustering, using QIIME with UCLUST method.¹¹ (link) The alpha and beta diversity (rarefied samples) analyses were calculated with QIIME and statistical analyses, e.g., redundancy analysis (RDA) and Principal coordinates analysis (PCoA), were done with R-project (http://www.R-project.org/), using BiodiversityR¹² and Vegan¹³ libraries. A graphical comparison of relative abundance (percentage of bacterial community at the classification level of genus) was made with three usual foods well known for their spontaneous fermentation process or decay (wine grape¹⁴ (link); table olives¹⁵ (link) and cocoa bean¹⁶ (link)). These comparisons were graphically achieved without any bioinformatics treatment on the data.

Moura F.G., Graças D.A., Santos A.V., Silva A.L, & Rogez H. (2018). Dynamics and diversity of the bacterial community during the spontaneous decay of açai (Euterpe oleracea) fruits. Brazilian Journal of Microbiology, 49(Suppl 1), 25-33.

+ Open protocol

+ Expand

16S rRNA Gene Amplicon Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bacterial DNA was extracted from 0.2 mg of each sample using the PowerSoil™ DNA isolation kit (MO BIO) under manufacturer’s conditions. DNA samples were treated with 100 μL of the elution buffer and stored at −20 °C until further processing. The V1–V2 regions of 16S rRNA genes were amplified with primer pairs F27 (5′-AGAGTTTGATCCTGGCTCAG-3′) and R338 (5′-TGCTGCCTCCCGTAGGAGT-3′). Both primers included sequencing adaptors at the 5′ end, and forward primers were tagged with different barcodes. The PCR mixture (50 μL) contained 2 μL DNA template (~5 ng), 5 μL of 10x AccuPrime™ PCR Buffer II, 0.2 μM of each primer and 1 U of AccuPrime™ Taq DNA Polymerase High Fidelity (Invitrogen, Life Technologies, Carlsbad, CA, USA). The PCR thermal profile was 2 min at 94 °C followed by 30 cycles of 1 min at 94 °C, 1 min at 55 °C, 1 min at 72 °C and a final extension of 7 min at 72 °C. To check the absence of reagents contamination, each PCR included a negative control. For each amplicon, both concentration and quality were determined using Agilent Bioanalyzer 2100. Samples were sequenced on an Ion Torrent Personal Genome Machine (PGM) with the Ion 318 Chip Kit v2 (Life Technologies) and the Ion PGM^TM Sequencing 400 Kit (Life Technologies) under manufacturer’s conditions. The raw sequences were deposited in NCBI under the Bioproject accession number PRJNA723169.

Garrido V., Migura-García L., Gaitán I., Arrieta-Gisasola A., Martínez-Ballesteros I., Fraile L, & Grilló M.J. (2021). Prevalence of Salmonella in Free-Range Pigs: Risk Factors and Intestinal Microbiota Composition. Foods, 10(6), 1410.

+ Open protocol

+ Expand

Gut Microbiome Profiling from Fecal Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA from fecal samples was extracted using QIAamp FAST DNA Stool Kit (QIAGEN) with additional digestion in the presence of lysozyme (20 mg/ml). Variable V5 and V6 regions of the 16S rRNA gene were amplified from DNA from fecal samples using the barcoded forward fusion primer CCATCTCATCCCTGCGTGTCTCCGACTCAGATTAGATACCCYGGTAGTCC in combination with the reverse fusion primer CCTCTCTATGGGCAGTCGGTGATACGAGCTGACGACARCCATG. The sequences include IonTorrent PGM-specific adaptors (in italics) that are required for high throughput sequencing. The PCR-amplified 16S V5-V6 amplicons were purified from agarose gels using Qiagen Gel extraction kit (according to manufacturer’s instructions) and then prepared for sequencing on the IonTorrent PGM system using Ion PGM^TM Template OT2 400 Kit and Ion PGM^TM Sequencing 400 Kit according to the manufacturer’s instructions (Life Technologies). The number of reads obtained per sample was between 7000 and 65000. Data analysis was performed using the QIIME pipeline version 1.8.0. Operational taxonomic units (OTU) were picked using uclust [36 (link)] and the latest greengenes database (http://greengenes.secondgenome.com).

De Riva A., Wållberg M., Ronchi F., Coulson R., Sage A., Thorne L., Goodfellow I., McCoy K.D., Azuma M., Cooke A, & Busch R. (2017). Regulation of type 1 diabetes development and B-cell activation in nonobese diabetic mice by early life exposure to a diabetogenic environment. PLoS ONE, 12(8), e0181964.

+ Open protocol

+ Expand

Ion PGM Sequencing for Plasmid DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid DNA concentration was assessed using Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). Ten nanograms of DNA was employed to prepare barcoded libraries with the Ion Plus Fragment Library kit (Life Technologies). Template preparation and enrichment was performed with the Ion OneTouch^TM 2 System (Life Technologies). Finally, sequencing was carried out using Ion 318TM chips on the Ion PGM System (PGM^TM, Life Technologies) and with the Ion PGM^TM Sequencing 400 kit. Sequence gaps were filled by PCR and sequenced using primer walking. Lasergene sequence analysis software system was used to align the sequence.

Ding B., Shen Z., Hu F., Ye M., Xu X., Guo Q, & Wang M. (2016). In vivo Acquisition of Carbapenemase Gene blaKPC-2 in Multiple Species of Enterobacteriaceae through Horizontal Transfer of Insertion Sequence or Plasmid. Frontiers in Microbiology, 7, 1651.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!