Log In Sign up
The largest database of trusted experimental protocols

Abi prism dyedeoxy terminator cycle sequencing kit

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United Kingdom

The ABI PRISM DyeDeoxy Terminator Cycle Sequencing Kit is a reagent kit used for DNA sequencing. The kit contains the necessary components for performing the Sanger sequencing method, including dye-labeled dideoxynucleotides, DNA polymerase, and other essential buffers and reagents.

Automatically generated - may contain errors

Lab products found in correlation

Abi 3100 genetic analyzer, by Thermo Fisher Scientific (3 mentions) Qiaamp blood kit, by Qiagen (2 mentions) Abi 3130xl genetic analyzer, by Thermo Fisher Scientific (2 mentions) Ex taq dna polymerase, by Takara Bio (1 mentions) Cpgenome fast dna modification kit, by Merck Group (1 mentions) Abi 3500xl dna sequencer, by Thermo Fisher Scientific (1 mentions) Epitaq hs, by Takara Bio (1 mentions) Ion ampliseq library kit 2, by Thermo Fisher Scientific (1 mentions) Ion ampliseq brca1 and brca2 panel, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

ABI Prism Terminator Cycle Sequencing kit (6 citations)

8 protocols using abi prism dyedeoxy terminator cycle sequencing kit

1

BRCA1/2 Coding Regions Sequencing

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
A subset of clinical samples (11 samples of TS and 60 samples of VS) were sequenced for the entire coding regions by Sanger sequencing. Sequencing was performed using an ABI PRISM DyeDeoxy Terminator Cycle Sequencing Kit and an ABI 3100 Genetic Analyzer (Applied Biosystems, Warrington, UK) according to Coppa et al. (2018) (link).
The reference sequence for BRCA1 was NM_007294.3, and the reference sequence for BRCA2 was NM_000059.3.
Nicolussi A., Belardinilli F., Mahdavian Y., Colicchia V., D’Inzeo S., Petroni M., Zani M., Ferraro S., Valentini V., Ottini L., Giannini G., Capalbo C, & Coppa A. (2019). Next-generation sequencing of BRCA1 and BRCA2 genes for rapid detection of germline mutations in hereditary breast/ovarian cancer. PeerJ, 7, e6661.
+ Open protocol
+ Expand
2

BRCA1 and BRCA2 Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
All clinical samples were sequenced for the entire coding regions by Sanger sequencing, using an ABI PRISM DyeDeoxy Terminator Cycle Sequencing Kit and an ABI 3100 Genetic Analyzer (Applied Biosystems, Warrington, UK). Reference sequence for BRCA1 was Genbank, NM_007294.3, and reference sequence for BRCA2 was Genebank, NM_000059.3.
Nicolussi A., Belardinilli F., Silvestri V., Mahdavian Y., Valentini V., D’Inzeo S., Petroni M., Zani M., Ferraro S., Di Giulio S., Fabretti F., Fratini B., Gradilone A., Ottini L., Giannini G., Coppa A, & Capalbo C. (2019). Identification of novel BRCA1 large genomic rearrangements by a computational algorithm of amplicon-based Next-Generation Sequencing data. PeerJ, 7, e7972.
+ Open protocol
+ Expand
3

Phylogenetic Analysis of Respiratory Syncytial Virus

Check if the same lab product or an alternative is used in the 5 most similar protocols
To establish a phylogenetic tree, viral RNA was extracted from 96 randomly selected samples (4.7% of all samples). The method used to generate the phylogenetic trees was previously described [20] (link). The specific primers used were:
RSV A: Forward – 5′-GTACCYTGCAGCATATGCA-3′, Reverse 5′-CAAMTCCATTGTTATTTGCC-3′.
RSV B: Forward 5′-ATGATTWYCAYTTTGAAGTGTTC-3′, Reverse 5′-GAATAACTAAGCATRTGA-3′The 471 bp RSV A PCR products and 484 bp RSV B PCR products were purified using the Qiagen® High Pure PCR Product Purification Kit (Roche® Diagnostics GmbH, Mannheim, Germany) and sequenced using the ABI PRISM Dye Deoxy Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). Reaction mixtures were analyzed on the Applied Biosystems model 3100 DNA automatic sequencing systems.
The Sequencher® 5.0 program (Gencodes Corporation, Ann Arbor, MI) was used to compare the nucleotide sequences. Phylogenetic trees were prepared by nearest neighbor joint analysis using Clustal × with 1000 bootstraps, and trees were visualized using TreeView or NJ plot software. Phylogenetic trees were prepared using 50 RSV A sequences and 36 RSV B sequences. Sequences were deposited in the GeneBank (GenBank accession numbers: KF981452 -KF981469).
Hirsh S., Hindiyeh M., Kolet L., Regev L., Sherbany H., Yaary K., Mendelson E, & Mandelboim M. (2014). Epidemiological Changes of Respiratory Syncytial Virus (RSV) Infections in Israel. PLoS ONE, 9(3), e90515.
+ Open protocol
+ Expand
4

BRCA1 Large Deletion Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Newly discovered BRCA1 large deletions were validated by characterization of the genomic breakpoints. Long-range PCR was performed according to the manufacturer’s instructions using the kit Platinum Taq DNA polymerases High Fidelity (Thermo Fisher) with the primers sitting on closer undeleted exons as described in Table S2. PCR products were purified with ExoSAP-IT (USB Corp., Cleveland, USA) according to the manufacturer’s instructions and sequenced using the ABI PRISM DyeDeoxy Terminator Cycle Sequencing Kit and an ABI 3100 Genetic Analyzer (Applied Biosystems, Warrington, UK). Reference sequences for BRCA1 and BRCA2 are in GenBank; NM_007294.3 and NM_000059.3, respectively.
Nicolussi A., Belardinilli F., Silvestri V., Mahdavian Y., Valentini V., D’Inzeo S., Petroni M., Zani M., Ferraro S., Di Giulio S., Fabretti F., Fratini B., Gradilone A., Ottini L., Giannini G., Coppa A, & Capalbo C. (2019). Identification of novel BRCA1 large genomic rearrangements by a computational algorithm of amplicon-based Next-Generation Sequencing data. PeerJ, 7, e7972.
+ Open protocol
+ Expand
5

BRCA1/2 Mutation Screening Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from peripheral blood samples using a commercial kit (QIAamp Blood Kit, Qiagen, Valencia, CA). The entire coding sequence and all intron/exon boundaries of BRCA1 and BRCA2 were screened by direct sequencing using an ABI PRISM DyeDeoxy Terminator Cycle Sequencing Kit and an ABI 3130XL Genetic Analyzer (Applied Biosystems, Warrington, UK) as previously described 19, 20. Sequences were compared against BRCA1 and BRCA2 reference sequences (GenBank NM_007294.3 and NM_000059.3; additional GenBank reference sequence were as follows: ATM, NM_000051.3; CHEK2, NM_007194.3; RAD50, NM_005732.3). DNA mutation nomenclature followed current guidelines of the Human Genome Variation Society (http://www.hgvs.org/rec.html). BRCA1/2 genomic rearrangements were searched for by the Multiple‐Ligation‐dependent‐Probe‐Amplification (MLPA) methodology according to the manufacturer's instructions (MRC–Holland, Amsterdam, the Netherlands) and as described 22.
Coppa A., Nicolussi A., D'Inzeo S., Capalbo C., Belardinilli F., Colicchia V., Petroni M., Zani M., Ferraro S., Rinaldi C., Buffone A., Bartolazzi A., Screpanti I., Ottini L, & Giannini G. (2017). Optimizing the identification of risk‐relevant mutations by multigene panel testing in selected hereditary breast/ovarian cancer families. Cancer Medicine, 7(1), 46-55.
+ Open protocol
+ Expand
6

Methylation Profiling of APC Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The methylation state of the Apc promoter region was determined by sodium bisulfite treatment of either 1000 ng of genomic DNA with the CpGenome Fast DNA Modification kit or 80–300 ng of genomic DNA with the CpGenome Turbo DNA Modification kit (Merck Millipore, Burlington, MA), after which the nucleotide sequence was determined according to the manufacturer’s instructions. Because it was difficult to amplify the entire CpG island within the Apc promoter with one primer set, two primer sets were used (hereafter referred to as CpG islands 1 and 2) (S1 Fig). Using bisulfite-treated DNA as a template, Ex Taq DNA polymerase (Takara Bio Inc., Shiga, Japan) was used to amplify CpG island 1, and EpiTaq HS (Takara Bio Inc.) was used to amplify CpG island 2. The reaction conditions are shown in S1 Table. The PCR product was cloned into pCR2.1-TOPO vectors using the TA cloning kit (TOPO TA Cloning H kit, Invitrogen, Carlsbad, CA). An ABI PRISM Dye Deoxy Terminator Cycle Sequencing Kit and an ABI 3500xl DNA Sequencer (Applied Biosystems, Foster City, CA) were used to determine the CpG methylation status of the Apc promoter region, and at least four clones per tumor were sequenced.
Iizuka D., Sasatani M., Ishikawa A., Daino K., Hirouchi T, & Kamiya K. (2023). Newly discovered genomic mutation patterns in radiation-induced small intestinal tumors of ApcMin/+ mice. PLOS ONE, 18(10), e0292643.
+ Open protocol
+ Expand
7

Phylogenetic Analysis of H3N2 Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols
To establish a phylogenetic tree, from randomly selected samples. The specific primers used were:
H3N2-F6 H3N2-F6 5′ AAGCAGGGGATAATTCTATTAACC 3′
H3HA-R1075 5′ AACCGTACCAACCRTCCACCATTC 3′
RT-PCR products were sequenced using ABI PRISM Dye Deoxy Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). Reaction mixtures were analyzed on Applied Biosystems
The Sequencher® 5.0 program (Gencodes Corporation, Ann Arbor, MI) was used to compare the nucleotide sequences. Phylogenetic trees were prepared by nearestneighbor joining analysis using Clustal X with 1000 bootstraps and trees were visualized using TreeView or NJ plot software.
Selected sequences were deposit in GenBank (KT006534-KT006349).
Mandelboim M., Glatman-Freedman A., Drori Y., Sherbany H., Pando R., Sefty H., Zadka H., Shohat T., Keller N, & Mendelson E. (2015). Ineffectiveness of the 2014-2015 H3N2 influenza vaccine. Oncotarget, 7(2), 1185-1192.
+ Open protocol
+ Expand
8

BRCA1 and BRCA2 Gene Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from peripheral blood samples using a commercial kit (QIAamp Blood Kit, Qiagen, Valencia, CA). The entire coding regions of the BRCA1 and BRCA2 genes were amplified using the Ion AmpliSeq BRCA1 and BRCA2 Panel, the Ion AmpliSeqTM Library Kit 2.0 and the Ion XpressTM Barcode Adapter 1‐16 Kit (Thermo Fisher Scientific, Waltham, MA, USA) to generate Ion Torrent adapter‐barcode ligated libraries, according to the manufacturer's procedures, as previously described (Nicolussi et al., 2019). The average depth of total coverage was set at minimum 500× and for variant calls at minimum of 100×. The NGS results were confirmed by direct sequencing using an ABI PRISM DyeDeoxy Terminator Cycle Sequencing Kit and an ABI 3130XL Genetic Analyzer (Applied Biosystems, Warrington, UK) as described previously (Coppa et al., 2014). Reference sequences were GenBank NM_007294.3 (NP_009225.1) and NM_000059.3 (NP_000050.3) for BRCA1 and BRCA2, respectively. DNA variant nomenclature followed current guidelines of the Human Genome Variation Society (http://www.hgvs.org/rec.html).
Nicolussi A., Belardinilli F., Ottini L., Petroni M., Capalbo C., Giannini G, & Coppa A. (2020). A novel BRCA2 splice variant identified in a young woman. Molecular Genetics & Genomic Medicine, 8(12), e1513.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!