Pac sgrna cas9

Actinomycin D and DNA oligonucleotides were purchased from Sigma-Aldrich. Puromycin, hygromycin were purchased from InvivoGen. pAC-sgRNA-cas9 and pAC-y1sgRNA-cas9 plasmids were obtained from Addgene (# 49330 and 49331). Anti-LDH (H-160) antibody was purchased from Santa Cruz (sc-33781). Anti-actin (A2066) antibody was purchased from Sigma-Aldrich. dTIS11 monoclonal antibody was produced as previously described^{46 (link)}.

The dTat knock‐out cell line was made from S2‐DRSC (DGRC Stock 181; https://dgrc.bio.indiana.edu//stock/181; RRID:CVCL_Z992) using protocols created by Bassett et al (2014 (link)). A pair of 20‐mer oligonucleotides targeting the 5′ end of the dtat coding sequence (GTTCGCGCAGCCAATCATCA) was ligated into pAc‐sgRNA‐Cas9 (Addgene) and validated by sequencing. The construct was transfected into low‐pass S2 cells using TransIT Insect transfection reagent (Mirus) and stable cells carrying indels for this locus were selected with 5 μg/ml puromycin for 3 weeks. Loss of dTAT was validated by immunoblotting and immunofluorescence for acetylated α‐tubulin (Appendix Fig S2A and B). The dTAT knock‐out cell line will be distributed through the Drosophila Genomics Resource Center (Bloomington, IN, code DGRC#344).

The 20 nt guide RNA target sites were appended with common adaptor sequences and had the first nucleotide substituted for a G, to improve transcription from the U6:2 promoter. The final sequence was of the format shown in Fig. 2C. Oligonucleotide synthesis for the 68,340 sgRNA sequences was performed by CustomArray Inc, USA, and the assembled oligonucleotide pool was amplified using Phusion polymerase (NEB, UK) and oligonucleotides LibAmpF and LibAmpR (Table S1) with the following thermal cycling parameters (98°C 30 s, 30 cycles of (98°C 15 s, 55°C, 30 s, 72°C 30 s), 72°C 5 min). PCR products were purified using a PCR purification kit (Qiagen, UK), digested with BspQ I (NEB), and 20 nt fragments were extracted from a 20% acrylamide-TBE gel (Life Technologies, UK). Gel extraction was performed by homogenising gel pieces and overnight incubated in 600 μL 0.3 mol/L NaCl. DNA was purified by ethanol precipitation and cloned into pAc-sgRNA-Cas9 (Addgene, #49330, USA) also cut with BspQ I. Approximately 7 × 10⁶ transformants were obtained, corresponding to at least 100-fold coverage of the initial library. Colonies were scraped from bacterial plates and DNA was extracted using a maxiprep kit (Qiagen).