The above oligonucleotides were annealed and added to a transcription reaction so that the final concentration was 0.1 μg/mL. Final concentrations of other components were 1× transcription buffer (Thermo Fisher), 10 mM DTT, 0.3 mM each ATP, GTP, and UTP, 0.5 pmol/ml alpha-32P CTP (3000Ci/mmol), 0.02 mM CTP, T7 RNA polymerase (Thermo Fisher). After 2 h incubation at 37°C, additional T7 polymerase was added and incubation continued for another 2 h. RQ1 DNase buffer was then added to 1× final concentration along with RQ1 DNase (Promega) and incubated at 37°C for 20 min. The RNA was ethanol precipitated and resuspended in TE. This was mixed 1:1 with formamide loading dye (93% formamide, 30 mM EDTA, 0.1× TBE, 0.5% bromophenol blue, 0.5% xylene cyanol), heated to 95°C for 5 min and loaded on a 8% acrylamide 7 M urea gel buffered with 1× TBE. After electrophoresis, bands were cut out of the gel and the RNA was extracted with 0.3 M sodium acetate at room temperature for 1 h. Samples were centrifuged briefly, liquid was removed, transferred to a Spin-X column (Corning), centrifuged, and ethanol precipitated. This procedure was then repeated. After ethanol precipitation, the pellet was resuspended in H2O.
Spin x column
Manufactured by Corning
Sourced in United States
The Spin-X column is a centrifugal filter device used for the separation and concentration of samples. The column features a microcentrifuge tube design with a cellulose acetate membrane filter for the efficient removal of particles, cells, and macromolecules from solution.
Automatically generated - may contain errors
Lab products found in correlation
Protease inhibitor cocktail, by Roche (6 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Igepal, by Merck Group (4 mentions)
Protease inhibitor cocktail, by Merck Group (4 mentions)
Odyssey infrared imaging system, by LI COR (4 mentions)
Dc protein assay kit, by Bio-Rad (3 mentions)
Bovine serum albumin (bsa), by Merck Group (2 mentions)
Gfp trap a beads, by Proteintech (2 mentions)
Anti flag, by Merck Group (2 mentions)
Western lighting plus ecl reagent, by PerkinElmer (2 mentions)
Clone it 57, by BEI Resources (2 mentions)
Transcription buffer, by Thermo Fisher Scientific (1 mentions)
T7 polymerase, by Promega (1 mentions)
Rq1 dnase buffer, by Promega (1 mentions)
Rq1 dnase, by Promega (1 mentions)
T7 rna polymerase, by Thermo Fisher Scientific (1 mentions)
Sybr gold nucleic acid gel stain, by Thermo Fisher Scientific (1 mentions)
Genegreen dye, by Tiangen Biotech (1 mentions)
Glycogen, by Thermo Fisher Scientific (1 mentions)
T4 polynucleotide kinase, by Thermo Fisher Scientific (1 mentions)
44 protocols using spin x column
1
In Vitro Transcription of Radiolabeled RNA
2
Radiolabeled Compound Stability Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro stabilities
in phosphate-buffered saline (PBS, pH=7.4) or mouse serum were determined
similarly to our previously described procedures with minor modifications.20 (link)99mTc-DTPA-CB86 (5.55 MBq) in 250
μL of PBS was added to 2.0 mL of PBS or mouse serum and incubated
at 37 °C for 1, 2, and 4 h. At each time point, the mixture in
the mouse serum 1.85 MBq was precipitated with 300 μL of ethanol
and centrifuged at 16 000g for 2 min. The
supernatant was transferred to a new Eppendorf tube, and DMF (300
μL) was added to precipitate the residue of serum protein. After
centrifugation, the supernatant or the mixture in saline was acidified
with 300 μL of buffer A (water + 0.1% trifluoroacetic acid (TFA))
and filtered using a 0.2 μm nylon Spin-X column (Corning Inc.
Corning, New York). The filtrates were then analyzed by radio-HPLC
under conditions identical to the ones used to analyze the original
radiolabeled compound. The percentage of intact 99mTc-DTPA-CB86
was determined by quantifying peaks corresponding to the intact and
the degradation products. The assays were repeated twice.
in phosphate-buffered saline (PBS, pH=7.4) or mouse serum were determined
similarly to our previously described procedures with minor modifications.20 (link)99mTc-DTPA-CB86 (5.55 MBq) in 250
μL of PBS was added to 2.0 mL of PBS or mouse serum and incubated
at 37 °C for 1, 2, and 4 h. At each time point, the mixture in
the mouse serum 1.85 MBq was precipitated with 300 μL of ethanol
and centrifuged at 16 000g for 2 min. The
supernatant was transferred to a new Eppendorf tube, and DMF (300
μL) was added to precipitate the residue of serum protein. After
centrifugation, the supernatant or the mixture in saline was acidified
with 300 μL of buffer A (water + 0.1% trifluoroacetic acid (TFA))
and filtered using a 0.2 μm nylon Spin-X column (Corning Inc.
Corning, New York). The filtrates were then analyzed by radio-HPLC
under conditions identical to the ones used to analyze the original
radiolabeled compound. The percentage of intact 99mTc-DTPA-CB86
was determined by quantifying peaks corresponding to the intact and
the degradation products. The assays were repeated twice.
3
Primer Extension Sequencing Protocol
4
Extracting Small RNA Fragments from Polyacrylamide Gel
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR products were separated on a 6% polyacrylamide gel and visualized using GeneGreen dye (TIANGEN). The 130– to 160–base pair (bp) DNA fragments corresponding to the small RNA fraction were cut off from the gel. The gel piece was smashed, and DNA was eluted in TE buffer [10 mM tris (pH 7.5) and 1 mM EDTA] overnight with rotation at room temperature. The liquid phase was passed through a 0.45-μm Spin-X column (Corning), followed by precipitation with 10 μg of linear acrylamide, 1/10 volume of 3 M sodium acetate (pH 5.2), and three volumes of ethanol.
5
Synthetic sRNA Labeling and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One hundred nanograms of synthetic sRNA (5’-UGAUUGAGCCGCGCCAAUAUC-3’) was 5’ end labeled by T4 polynucleotide kinase (Fermentas) with 32P isotope. After the reaction was stopped, 10 ng was saved for further process and the rest was mixed with 500 ng of unlabeled synthetic RNA with the sequence of 5’-UAUUGGCGCGGCUCAAUCAGA-3’. The mixture was heated to 95°C for 2 minutes in a thermocycler and was cooled to 5°C (2°/2 min) to gain 19 nt perfectly matched double strand with 2 nt protruding at the 3’ end. The sufficient amount of DNA loading dye was added to the mixture and to the saved labeled single stranded RNA. Both samples were run on a 8% acrylamide:bis-acrylamide 19:1 1xTBE gel. Gel was directly exposed. The dsRNA region was cut from the gel. The gel piece was shredded using a 0.5 ml tube with several holes in the bottom in a 2 ml tube via centrifugation. The shredded gel pieces were shaken overnight in 500 μl of 300 mM NaCl at 4°C. Gel pieces were filtered out by using Spin-X column (Corning). 400 μl of dsRNA solution was precipitated by adding 20 μg glycogen (Fermentas) and 1 ml ethanol. The precipitated ds-RNA was resolved in IP buffer described before.
6
Serum Stability Assay for 18F-FP-3-4A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
18F-FP–3-4A
(3.7–5.55 MBq [100–150 μCi]) was incubated in
0.5 mL of mouse serum for 1 h at 37 °C. The mixture was then
treated with 0.5 mL of acetonitrile to precipitate the serum protein
and centrifuged at 16000g for 2 min. The supernatant
containing greater than 95% of the radioactivity was filtered using
a 0.22 μm nylon SpinX column (Corning Inc.). Greater than 99%
of the radioactivity passed through this filter. In addition, 18F-FP–3-4A (3.7–5.55 MBq [100–150 μCi])
was also incubated in PBS buffer for 1 h at room temperature. The
samples were analyzed by radio-HPLC. The high sensitive Bioscan detector
and low sensitivity Ramsey detector were used for analysis of mouse
serum stability sample and PBS sample, respectively. The percentage
of intact peptide was determined by quantifying peaks corresponding
to the intact peptide and degradation products.17 (link)
(3.7–5.55 MBq [100–150 μCi]) was incubated in
0.5 mL of mouse serum for 1 h at 37 °C. The mixture was then
treated with 0.5 mL of acetonitrile to precipitate the serum protein
and centrifuged at 16000g for 2 min. The supernatant
containing greater than 95% of the radioactivity was filtered using
a 0.22 μm nylon SpinX column (Corning Inc.). Greater than 99%
of the radioactivity passed through this filter. In addition, 18F-FP–3-4A (3.7–5.55 MBq [100–150 μCi])
was also incubated in PBS buffer for 1 h at room temperature. The
samples were analyzed by radio-HPLC. The high sensitive Bioscan detector
and low sensitivity Ramsey detector were used for analysis of mouse
serum stability sample and PBS sample, respectively. The percentage
of intact peptide was determined by quantifying peaks corresponding
to the intact peptide and degradation products.17 (link)
7
Mucosal Secretions Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mucosal secretions were eluted from weck- cel sponges using a reported protocol [46 (link)] with slight modifications. Briefly, the elution buffer was prepared by adding 50 μl of 100x protease inhibitor cocktail and 250 μl of Igepal (Sigma, St Louis, MO) to 4.7 ml of phosphate buffer saline containing 0.25% of bovine serum albumin (Sigma, St Luis, MO). Sponges were thawed at room temperature then transferred tip down to the upper chamber of a spinX column (Corning Life Sciences, Lowell, MA), then 50 μl of ice-cold elution buffer were added. The buffer was allowed to diffuse for 15 minutes followed by a centrifugation of the tubes at 20,000 G at 4 C for 10 minutes. The procedure was repeated twice, and then the eluted fractions were concentrated.
8
TiO2 Phosphopeptide Enrichment Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TiO2 enrichment was conducted using a TiO2 Mag Sepharose kit (GE Healthcare)85 (link),86 (link). Essentially, 600 µg aliquots of TMT8-plex-tagged tryptic peptides were reconstituted in 400 µL buffer containing 1 M glycolic acid, 80% ACN, and 5% trifluoroacetic acid (TFA) and incubated with 100 µL TiO2 beads for 30 min with 1800 rpm vortex. After washing the beads with 80% ACN and 1% TFA, the phospho-peptides were eluted 3 times with each 200 µL 5% ammonium hydroxide. The eluted fractions were pooled, filtered through a Spin-X column (22 µm pore size; Corning Inc., Corning, NY), dried, and reconstituted in 50 µL 0.5% FA for subsequent nanoLC–MS/MS analysis.
9
Semiconductor Electrochemical Tag Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 4637 tags were synthesized using CustomArray's semiconductor electrochemical process in duplicate. Forward and reverse tag sets were amplified in 24 parallel 50 µl reactions from 1.25 × 10−14 moles template/reaction using FP: 5′- CGACAGTAACTACACGGCGA -3′ and RP: 5′- GTCGTGACTGGGAAAAC -3′ with Kapa Hifi Hotstart Readymix for 17 cycles. Ten nanomolar PCR products were digested with NEB lambda exonuclease following manufacturer's protocol. A 113 ng sample was mixed with equivolume Novex TBE Urea Sample Buffer and heated at 70°C for 3 min, then chilled on ice. Samples and ladder were run on a Novex TBE Urea Gel, and the corresponding 50 bp band was cut. The bands were diced and spun through a 600 ml Eppendorf with a hole from a 22 gauge needle. The slurries were incubated with TE buffer at 65°C for 2 h and purified on a Spin-X column (Corning). Purified DNA was treated with the Qiagen nucleotide removal kit per manufacturer's protocol.
10
Immunoprecipitation of LRRK2 Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lysates were prepared in lysis buffer (1.0 ml per 15 cm dish) and subjected to immunoprecipitation with anti-FLAG M2 agarose or GFP-Trap A beads (Chromotek) at for 1 h. Beads were washed twice with Lysis Buffer supplemented with 300 mM NaCl, then twice with Buffer A. Immune complexes were either used in kinase assays or incubated at 70°C for 10 min, passed through a Spin-X column (Corning) to separate the eluate from the beads, then boiled in LDS sample buffer. LRRK2 transfected HEK293 cell lysates were subjected to immunoprecipitation as with GFP-Trap beads. For endogenous immunoprecipitation assays, LRRK2 was immunoprecipitated using Anti-LRRK2 (UDD3, Abcam) non-covalently conjugated to protein-A sepharose (1 μg antibody: 1 μl bead) and analyzed by immunoblotting.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!