Genomic DNA was extracted from 200 μL samples of peripheral blood leukocytes from all participants by using a Blood DNA Isolation Kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. The specific fluorescent probes for single nucleotide polymorphism (SNP) (rs591291, rs619586, and rs3200401) genotyping were purchased from ABI (Thermo Fisher Scientific, United States). Genotyping of the three SNPs was performed in a 384-well plate on an ABI Q6 instrument (Thermo Fisher Scientific, United States) according to the TaqMan real-time polymerase chain reaction protocol. A random selection of 10% of the samples was repeated for detection, and the results showed 100% concordance.
Abi q6
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI Q6 is a real-time PCR system designed for nucleic acid amplification and detection. It features a 96-well sample block and supports a range of fluorescent chemistries for sensitive and precise quantification of DNA and RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Blood dna isolation kit, by Tiangen Biotech (2 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Sybr green realtime pcr master mix, by Toyobo (2 mentions)
Tianamp blood dna kit, by Tiangen Biotech (1 mentions)
Sybr green pcr master mix, by Roche (1 mentions)
Hiscript q rt supermix for qpcr, by Vazyme (1 mentions)
Aceq sybr green master mix, by Vazyme (1 mentions)
Trizol reagent, by Vazyme (1 mentions)
Revertaid first strand dna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr kit, by Roche (1 mentions)
Pcr sybr premix ex taq 2, by Takara Bio (1 mentions)
First strand cdna synthesis kit, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rt reagent kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Takara Bio (1 mentions)
14 protocols using abi q6
1
Genotyping of SNPs in Peripheral Blood Leukocytes
2
Genetic Profiling of Sepsis Patients
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood was collected in an EDTA tube from each sepsis patient and control. Following the guidance of the manufacturer’s instructions, genomic DNA was extracted with a Blood DNA Isolation Kit (Tiangen, Beijing, China), and then we stored these samples in the −80°C equipment before genotyping. A 384-well plate on an ABI Q6 instrument (Thermo Fisher Scientific, United States) was used for amplifying DNA samples according to the protocol of the TaqMan real-time polymerase chain reaction protocol. Specific fluorescent probes labeled with VIC or FAM for rs9839776, which can differentiate wild-type and variant alleles, were purchased from ABI (ThermoFisher Scientific, United States). The PCR reaction system include 2 × Genotyping PreMix, PCR primer pool and template DNA. The total reaction volume of each sample was 5 mL. The qPCR reaction step were as follows: predeformation needs 95°C for 2 min, then 40 cycles of 95°C for 15 s and 60°C for 30 s were set for amplify, and 60°C for 5 min for extension sufficiently.
3
Genomic DNA Extraction and Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We isolated total genomic DNA from peripheral blood leukocytes using the TIANamp Blood DNA Kit (TianGen Biotech Co., Ltd.). Genotyping of SNPs rs2288947 was performed in 384‐well plates by the TaqMan real‐time polymerase chain reaction protocol on an ABI Q6 (Thermo Fisher Scientific). In addition, approximately 10% of samples were randomly selected for sequencing for quality control purposes and validation of genotyping results. The results were 100% concordant.
4
Quantification of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and quantified and then reverse transcribed into complementary DNA (cDNA) using a Reverse Transcription kit (K1622; Thermo Fisher Scientific, Inc.). The procedure of reverse transcription was 25°C for 5 min, 42°C for 60 min, 70°C for 5 min. Primers (Table SI ) for actin, E-cadherin, Vimentin, GAPDH, circRNAs were obtained from Shanghai Sangon Pharmaceutical Co., Ltd., and the RT-qPCR analysis was performed using Applied Biosystems; Thermo Fisher Scientific, Inc. (ABI Q6). The kit used for qPCR was 2X SYBR Green PCR Master Mix (Roche Diagnostics) and the thermocycling conditions were 95°C for 10 min, 45 cycles of 95°C for 15 sec; 60°C for 60 sec. The temperature of melt curve was 60 to 99°C. The actin and GAPDH was used as an internal control. Relative quantification and calculation were done through the comparative threshold (Cq) cycle method (2−ΔΔCq) (26 (link)).
5
Whole Blood RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from whole blood samples of patients using a total RNA extraction reagent (Solarbio, Beijing, China). The miRNA and mRNA reverse transcription reagents and PCR kits (Tiangen and Transgen Biotech, Beijing, China) were used according to the manufacturer’s instructions. The synthesized cDNA was amplified via real-time polymerase chain reaction (qPCR) (ABI Q6, Applied Biosystems Inc., Waltham, MA, USA). The primers used for PCR are listed in Table 1 . GAPDH was used as an internal references, and the relative expressions of mRNAs and miRNAs were calculated using the 2−ΔΔCt method.
6
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We isolated total RNAs from the collected tissue samples using Trizol reagent (Vazyme, China) according to the manufacturer's instructions. Complementary DNA (cDNA) was synthesized with HiScript Q RT SuperMix for qPCR (Vazyme, China). Quantitative real-time PCR experiments were performed with AceQ SYBR Green Master Mix (Vazyme, China) on the ABI Q6 (Applied Biosystems, USA). Expression of mRNA was normalized to that of the control gene rps3. The relative 2−ΔΔCt method was used to calculate the relative expression values (Livak and Schmittgen, 2001 (link)). All primers used in this analysis were listed in Supplementary Table 1 .
7
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary DNA was synthesized from the RNA using a reverse transcription kit (Thermo Bio, Waltham, MA, USA). PCR was performed using 2 × Master Mix kit (Roche, Basel, Switzerland) following the manufacturer's instructions, and assessed on an ABI Q6 (Applied Biosystems Inc., Carlsbad, CA, USA) thermocycler. The amplification program was 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 60 s. The primer sequences are shown in Table S2 . The expression levels were calculated using 2−ΔΔCT method. The expression level of GAPDH was used as the reference gene for normalization.
8
Quantifying circRNA and miRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol (Invitrogen, USA) according to the manufacturer's protocol. cDNA was synthesized from 1 μg of total RNA using the reverse transcription kit (Thermo Scientific, #K1622, Thermo Fisher Scientific, USA) according to the manufacturer's protocol. The amplified cDNA was analysed using real-time PCR (ABI Q6, Applied Biosystems Inc., USA) with the following primers: GAPDH (forward), CAAAATGGTGAAGGTCGGTGT; GAPDH (reverse), GAGGTCAATGAAGGGGTCGTT; circ_0001615 (forward), ATGTTTCTGGAGCAGCAAGTGA; circ_0001615 (reverse), CGAGAAGCCTGTCAACTGAG; NC (forward), UUCUCCGAACGUGUCACGUTT; NC (reverse), ACGUGACACGUUCGGAGAATT; miR-152-3p (forward), GCAGTCAGTGCATGACAGA; miR-152-3p (reverse), AGTGCGTGTCGTGGAGTCG; LRP6 (forward), ACAAATATACTGGCGAGGGTCT; LRP6 (reverse), GGAGACATCAAACACAAATGGGA; ATG5 (forward), TGCGGTTGAGGCTCACTTTA; ATG5 (reverse), GTTGATGGCCCAAAACTGGT.
9
Profiling Tumor-Associated RNA Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of key lncRNA, miRNA, and mRNAs were verified via real time PCR in tumor tissues and adjacent normal tissues from 40 patients (with 10 patients in each stage). The characteristics of the patients involved in the real time PCR analysis are shown in Supplement 4 . Total RNA was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed to cDNA using a RevertAid™ First Strand DNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). For miRNAs, the cDNA was synthesized using a specific gene primer. Real time PCR was carried out by a SYBR-Green PCR kit (Roche Diagnostics, Indianapolis, IN, USA) and using an ABI Q6 (Applied Biosystems, Foster City, USA). The PCR protocol was as follow: Degeneration at 95 °C for 10 min; 45 cycles of 95 °C for 15 sec and 60 °C for 60 sec; the fusion curve was established at 95 °C for 10 s, 60 °C for 60 s, and 95 °C for 15 sec. The primer sequences are given in Supplement 5 . Data was analyzed using the 2−ΔΔCt method while U6 and GAPDH were used as reference genes.
10
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue samples were lysed with TRIzol™ (ThermoFisher Scientific, MA, USA) and total RNA was extracted. Reverse transcription was performed using the first-strand cDNA Synthesis Kit (TaKaRa, Kyoto, Janpan) according to the manufacturer’s instructions. Real-time polymerase chain reaction (real-time PCR) was performed using SYBR Premix Ex Taq II PCR (TaKaRa, Kyoto, Japan) on ABI Q6 (Applied Biosystems, CA, USA) according to the manufacturer’s instructions. The sequences of the primers are shown in Supplementary Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!