Ultrapure rna kit dnase 1

Total RNA from cells was extracted using Ultrapure RNA Kit (DNase I) (CWBIO, Beijing, China) according to the manufacturer's instructions. Reverse transcription was performed using HiFiScript cDNA Synthesis Kit (CWBIO, Beijing, China). Real‐time PCR was performed using UltraSYBR Mixture (CWBIO, Beijing, China) and a CFX96™ Real‐Time PCR Detection System (Bio‐Rad, Hercules, CA, USA). The thermal cycling conditions included 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of 95°C for 15 s, 58°C for 30 s and 72°C for 30 s. Mouse β‐actin was used as internal control. The relative expression levels of each gene were analysed using the 2^‐ΔΔCt method. The primers were designed using Primer3Plus platform (http://www.bioinformatics.nl/primer3plus) and synthesized by Sangon Biotech (Shanghai, China). The sequences of forward and reverse primers for these genes are listed in Table S1.

Total RNA and miRNA were extracted from glioma specimens, normal brain tissues, and cells using the Ultrapure RNA Kit (DNase I; CWBIO, China) and the miRcute miRNA Kit(TIANGEN, China) following the manufacturers’ instructions. RNA was reverse transcribed to complementary DNA (cDNA) by using the TIANScript cDNA Kit (TIANGEN, China). The miRcute miRNA First-Strand cDNA Synthesis Kit (TIANGEN, China) was used to generate cDNA from miRNA. Primers for each transcript were synthesized by Invitrogen (Shanghai, China) and are listed in Table 2. U6 and GAPDH were used as endogenous controls for miRNA and gene expression detection, respectively. The SYBR®Green Real-time PCR Kit (Takara, Liaoning, China) and the miRcute Plus miRNA qPCR Detection Kit (TIANGEN, China) were used for qRT-PCR assays using the ABI 7500 Real-Time PCR System (Applied Biosystems, CA, USA). Relative expression was normalized to that of endogenous controls using the comparative cycle threshold method, and the fold change in gene expression was calculated using the 2^−ΔΔCt method.

We try to understand the impact of the interaction of BspJ with the NME2 and CKB proteins on the expression of these proteins. The pcDNA3.1-BspJ and pcDNA3.1 plasmids were transfected into HEK293T cells with Lipofectamine 3000 (Invitrogen, United States). After 24 h, add TRIzon Reagent (CWBIO, China) to lyse the cells, use Ultrapure RNA Kit (DNase I) (CWBIO, China) to extract cell total RNA, and then use HiFiScript cDNA Synthesis Kit (CWBIO, China) to reverse into cDNA. Using cDNA as a template, qRT-PCR was performed using the ABI QuantStudio^TM 5 (Thermo Fisher Scientific, United States) instrument and SYBR Green fluorescent DNA binding dye, which assays gene expression level of NME2 and CKB. The relative expression level normalization is for GAPDH. The sequences of primers were NME2-F: CCTGGGCTGGTGAAGTACATGAAC, NME2-R: TGGTGCCTGGCTTTGAATCTGC; CKB-F: CGACTTCAGA AGCGAGGCACAG, CKB-R: TCACTCCGTCCACCACCAT CTG and GAPDH-F: GGAGCGAGATCCCTCCAAA AT, GAPDH-R: GGCTGTTGTCATACTTCTCATGG. The amplification cycle steps are 95° for 30 s, 60° for 30 s, and 72° for 30 s. The 2^–ΔΔCT approach was used to calculate the qRT-PCR data, and the values were normalized based on the expression level of housekeeping genes.

Lycopersicon esculentum (Micro-Tom tomato) was used for plant transformation. Escherichia coli strains DH5α, XL10-Gold and Agrobacterium tumefaciens strain GV3101 (WeidiBio, Shanghai, China) were used in this experiment.
HPLC-grade formic acid, methanol and acetonitrile were purchased from Fisher (Emerson, IA, USA). ClonExpress Ultra One Step Cloning Kit, HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) and Taq Pro Universal SYBR qPCR Master Mix were purchased from Vazyme Biotech Co., Ltd. (Nanjing, China). Ultrapure RNA Kit (DNase I) was obtained from CWBIO. Co., Ltd. (Beijing, China). Plant genomic DNA kits, restriction enzymes and DNA Marker II were purchased from TianGen Biotech Co., Ltd. (Beijing, China). KOD One PCR master Mix was obtained from TOYOBO Biotech Co., Ltd. (Shanghai, China). The PBI121 and pCAMBIA1300 plasmids were from laboratory stock. The baicalein standard was obtained from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Other reagents were purchased from Beijing Chemical Corporation (Beijing, China) unless otherwise specified.

Total RNA was extracted from the BMECs using an Ultrapure RNA Kit (DNaseI, CWBIO, Jiangsu, China) to detect TERT expression levels. Primers for TERT were designed (General Biol, Anhui, China) (primer sequences: TERT-F TCTTGTCAGTCTTGCGGTTGA; TERT-R CAAAGGGAAGCCGAATCACAC), and the HiFiScript cDNA synthesis kit (CWBIO, Jiangsu, China) was used to synthesize the first-strand cDNA. Amplification was performed at 95 °C for 10 min, followed by 40 cycles at 95 °C for 10 s and at 60 °C for 30 s with UltraSYBR Mixture (CWBIO, Jiangsu, China).
Information about the position of the amplification was: NM_053423.1 Rattus norvegicus telomerase reverse transcriptase (Tert), mRNA, 2900-3043, amplification length 144bp. The final data were analyzed using the 2- Δ ΔCt method which was normalized to a housekeeping gene.