Lightcycler real time pcr

Total RNA was isolated using TRIzol (QIAGEN, Hilden, Germany), and cDNA was reverse transcribed from 1 µg of RNA using SuperScript IV reverse transcriptase (18090050; Invitrogen). The qPCR was performed with SYBR Green using a real-time PCR LightCycler (Roche Diagnostics, Sydney, Australia). The relative amount of cDNA was calculated by the comparative Ct method using the 18S ribosomal RNA sequence as control. The primer sequences were as follows: OGT (forward, CAGCATCCCAGCTCACTT and reverse, CAGCTTCACAGCTATGTCTTC); PDGFRB (forward, GATGCCGAGGAACTATTCATCT and reverse, TTTCTTCTCGTGCAGTGTCAC); PRKCG (forward, GCCACTAGGTGTCCCCAA and reverse, GAGAATATCGGGCTCCGCTC); S1PR3 (forward, CACCCGCTAGGATGCCG and reverse, CTCCAGCGAGGGCGTTG); and VCAN (forward, GAGATAAGATGGGAAAGGCAGG and reverse, GGGGACAGTGAGGTGGAACA).

QRT-PCR was used to accurately detect the changes of expression of selected relevant genes: ERK1 and STAT3 gene expression levels and ribosomal 18S RNA as reference sequence. Total RNA (1 μg) DNA-free was reverse-transcribed into cDNA using hexamers (Pharmacia Biotech, Orsay, France) and Superscript II Reverse Transcriptase (Invitrogen Life Technologies, France). Genes of interest and 18S rRNA were amplified, detected and quantified in real-time by using the Light Cycler Real-Time PCR (Roche Applied Science, Meylan, France). QRT-PCR was performed by using the oligonucleotides and sequence parameters described in Table 2 in a medium containing 1X LightCycler 480 SYBR Green I master mix, 0.25 μM of each primer and 20 ng of cDNA. Each PCR reaction was preceded by one activation cycle of 95°C for 5 min and ended by establishing a melting curve 5 degrees above the oligonucleotide melting temperature.Table 2

Description of oligonucleotides and sequence parameters for QRT-PCR

Name gene	Oligo direct	Oligo reverse	PCR conditions	Cycle number	GeneInfo identifier
18S	CTACCACATCCAAGGAAGGCA	TTTTTCGTCACTACCTCCCCG	95°C 15 sec	35	124517659
			67°C 30 sec
ERK1	CTAAAGCCCTCCAACCTGCT	CAGCCCACAGACCAGATGT	95°C 15 sec	45	158138506
			60°C 30 sec
STAT3	AAAGTCAGGTTGCTGGTCAAA	TGCCGTTGTTGGATTCTTC	95°C 15 sec	45	76253927
			60°C 30 sec

HRM analysis was conducted according to the method described by Jeong et al. [42 (link)] using a LightCycler^® Real-Time PCR (Roche, Basel, Switzerland). The melting curve was analyzed with High-Resolution Melt software version 1.1 (Roche), and the genotypes were classified into three groups: A (SP3B marker type), B (H6 marker type), and H (heterozygous marker type). The newly developed polymorphic HRM markers were added to the SP3B×H6 map and compared with the OH1×5225 genetic linkage map [30 (link)].

Genomic DNA was extracted from 50 μL EDTA-blood using the QIAamp Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. Determination of the IL-28B (rs12979860) and IFNL4 (rs368234815) genotype was performed by LightCycler real time PCR (Roche, Mannheim, Germany) using a commercial LightSNiP (SimpleProbe) assay purchased from TIB-MolBiol (Berlin, Germany) according to the manufacturer's recommendations.

PCR reaction for HRM analysis was prepared using 20 ng·μL⁻¹ genomic DNA, 10× PCR buffer, 2.5 mM dNTP mixture, 0.1 units Taq DNA polymerase (TransGen Biotech Co., Beijing, China), 0.5 μL SYTO^® 9 green, fluorescent nucleic acid stain (Life Technologies^TM, Carlsbad, CA, USA), and 10⁻⁵ μL of each primer in a final reaction volume adjusted to 20.0 μL, using TDW. Biometra TAdvanced (Analytik Jena AG, Jena, Germany) was used for the PCR reaction. After performing the initial denaturation at 95 °C for 5 min, denaturation at 95 °C for 10 s and the annealing/elongation process at 60 °C for 20 s were repeated 39 times. Next, a full extension reaction was carried out at 72 °C for 20 s. The PCR product was used to create a melting curve using LightCycler^® Real Time PCR (Roche Holding AG, Basel, Switzerland). The fluorescence value of SYTO^® 9 was measured at each temperature while raising the temperature by 0.03% from 65 °C to 97 °C. The melting curve graph was analyzed using High-Resolution Melt software v.1.1 (Roche Holding AG, Basel, Switzerland) for genotype analysis. Genotypes were classified into three groups: A (maternal homozygous), B (paternal homozygous), and H (heterozygous) (Figure S4 (Supplementary Materials)).

Genomic DNA was extracted from 200 μl EDTA-blood using the QIAamp Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Determination of the PNPLA3 (rs738409), CSPG3/NCAN (rs2228603), GCKR (rs780094), PPP1R3B (rs4240624), TM6SF (rs8542926), LYPLAL1 (rs12137855) and MBOAT7 (rs626283) polymorphisms was performed by LightCycler real time PCR (Roche, Mannheim, Germany) using commercial LightSNiP (SimpleProbe) assays from TIB-MolBiol (Berlin, Germany) according to the manufacturer’s recommendations. All PCRs for SNPs determination were repeated by two independent investigators (C.L and H.D.N), in order to ensure correct typing results.

MMP2 and MMP9 gene and 18S, B-actin and GAPDH reference gene expressions were assayed by RT-qPCR (Additional file 2: Table S1). Total RNA was reverse transcribed and target genes were quantified by amplification using the Light Cycler Real- Time PCR (Roche Applied Science, Meylan, France). RT-qPCR was performed by using a medium containing 1X LightCycler 480 SYBR Green I master mix, 0.25 μM of each primer and 20 ng of cDNA. Each PCR reaction was preceded by one activation cycle of 95 °C for 5 min and ended by establishing a melting curve 5 degrees above the oligonucleotide melting temperature.