Mouse embryos from a wild-type (wt) SWISS background of embryonic days (E) 12.5 were dissected into PBS and fixed overnight in 4% PFA at 4°C. Embryos were processed into paraffin wax, and 5 μm sections were made using a microtome. The probe corresponds to the 3′ coding region of Shroom4 (ENSMUSG00000068270). Two primers were used to amplify a 995 bp region from mouse embryo cDNA (forward: TTGGGGCCCGAAAGAAGGTC, reverse: TTCCCTGCCATCCACATGCT), and at the reverse primer, a T7 polymerase sequence was included. The protocol of the probe generation can be found online (http://mamep.molgen.mpg.de ). In vitro transcription was performed using a nucleotide mix containing digoxigenin-11-UTP (Roche). All samples were processed for ISH as described by Chotteau-Lelièvre et al24 (link) with minor modifications, and detection of AP activity was carried out using BM Purple (Roche). Images were obtained on a Leica M205C System with a colour camera.
M205c system
Manufactured by Leica
The M205C System is a stereomicroscope designed for precision optical inspection and analysis. It features a modular design, allowing for customization to meet specific research and laboratory requirements. The system delivers high-quality, detailed images through its advanced optics and lighting capabilities.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using m205c system
1
In Situ Hybridization of Shroom4 in Mouse Embryos
2
In Situ Hybridization Analysis of Shroom4 in Mouse Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse embryos from a wild-type (wt) SWISS background of embryonic days (E) 12.5 were dissected into PBS and fixed overnight in 4% PFA at 4°C. Embryos were processed into paraffin wax, and 5 µm sections were made using a microtome. The probe corresponds to the 3′ coding region of Shroom4 (ENSMUSG00000068270). Two primers were used to amplify a 995 bp region from mouse embryo cDNA (forward: TTGGGGCCCGAAAGAAGGTC, reverse: TTCCCTGCCATCCACATGCT), and at the reverse primer, a T7 polymerase sequence was included. The protocol of the probe generation can be found online (http://mamep.molgen.mpg.de ). In vitro transcription was performed using a nucleotide mix containing digoxigenin-11-UTP (Roche). All samples were processed for ISH as described by Chotteau-Lelièvre et al24 (link) with minor modifications, and detection of AP activity was carried out using BM Purple (Roche). Images were obtained on a Leica M205C System with a colour camera.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!