CRISPR guides flanking miR-148a were designed using crispr.mit.edu software from the Zhang lab (Cong et al., 2013 (link)). Selected guides, targeting regions upstream (gttctaatctgaggacgggt) and downstream (ccaattcccttgaagcgggt) of miR-148a were cloned separately into pL-CRISPR.SFFV.GFP (a kind gift from Benjamin Ebert; Addgene plasmid # 57827). Both vectors were co-transfected for 48h into MNT-1 melanoma cells using Fugen HD (Promega) according to manufacturer’s specifications, before single cell sorting into 96 well dishes. Once the cultures were established, the clones were screened by sequencing of the miR-148a locus. Generation of CRISPR line was more successful in MNT-1 line compare to other melanoma lines.
Fugen hd
Manufactured by Promega
Sourced in United States
Fugen HD is a high-performance thermal cycler designed for DNA amplification and gene expression analysis. It features rapid heating and cooling rates, high-precision temperature control, and intuitive software for seamless operation. The Fugen HD is a versatile and reliable instrument for a wide range of molecular biology applications.
Automatically generated - may contain errors
5 protocols using fugen hd
1
CRISPR-Mediated Knockout of miR-148a in Melanoma Cells
2
Regulation of MYC Promoter Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MYC gene promoter regions (Upstream 2000bp to downstream 30 bp) were amplified from human genomic DNA, and the PCR products were cloned into promoter vector pGL3-Basic (Promega) to generate pMYC-pro plasmid. The plasmid pMYC-pro was co-transfected with pcHBx-WT, pcHBx-SM, pcHBx-DM or pcHBxTM into 293 T cells using Fugen HD (E2311, Promega, USA) according to the manufacturer's protocol. In addition, the pRL-TK vector, which expresses Renilla luciferase, was also co-transfected to correct the differences in both transfection and harvest efficiencies. Cell lysate was collected 48 h after transfection, and luciferase activities were measured using a Promega Dual-Luciferase Reporter Assay System. The activity of the firefly luciferase reporter was normalized to that of the Renilla luciferase.
3
Retroviral Transduction Assay for Rat-1 Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Retroviral transduction of Rat-1 fibroblasts with human EVI1 was carried out as described previously (28 (link)), using FUGENHD (Promega)- transfected packaging Plat-E cells (MSCV-EVI1-IRES-GFP, MSCV-EVI1-AQA-IRES-GFP or empty vector control MSCV-IRES-GFP). After 4 days cells were FACS-sorted by GFP, and equal levels of EVI1 expression were confirmed by western blot (Supplementary Figure S5A–C ). GFP+ cells (104) were seeded in untreated methylcellulose medium (MethoCult™ M3231, Stem Cell Technology), or supplemented with 30 μM of H2O2. Alternatively, 1 × 105 cells in 100 μl (96-well plate) were left untreated or irradiated (0.5 or 2 Gy). After 14 days, colony number and size were quantified and documented using a DMIL inverted microscope fitted with a MC170 HD camera (Leica) (Supplementary Figure S5D ). Induction of DNA damage was assessed by induction of γH2AX foci (Supplementary Figure S5E ).
4
Lentiviral Cyclin D3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cyclin D3 WT and T283A mutant were cloned into pEXN‐MNCX using BamHI/NotI restriction sites. Cyclin D3‐containing lentiviral particles were produced as follows: 293T cells were transfected with pEXN‐MNCX‐cyclin D3 (TW or T283A) CMVi and pMD2.G using Fugen HD (Promega). Cell supernatants containing viruses were collected 48 h post‐transfection and frozen at −80°C.
5
Lentiviral Transduction of HUVECs for E-selectin Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A short hairpin RNA (shRNA) plasmid (ID: TRCN0000057790), delivered with a commercial lentiviral system (Sigma-Aldrich, St. Louis, MO, USA), was used for E-selectin knockdown in HUVECs. The scrambled and packaging plasmids were kindly provided by Dr. J. Luo, Peking University, Beijing, China. HEK-293FT cells were used for lentivirus preparation. For transfection, HEK-293FT cells were seeded at 1 × 10 4 cells/cm 2 in 2 mL culture medium, containing DMEM, 10% FBS, 1% NEAA, and 1 mM sodium pyruvate without penicillin and grown to 60% confluence.
Opti-MEM was used to form a transfection complex containing fugenHD (Promega, Madison, WI, USA) and packaging plasmids, before dropwise addition to the cells. The suspension was then incubated for 12-16 hours and replaced with DMEM supplemented with 30% FBS for 48 hours. The viruscontaining supernatants were obtained and filtered through a 0.45 μm filter. For infection, 500 μL virus-containing supernatants, 500 μL complete medium, and polybrene (final concentration: 8 μg/mL) were added. HUVECs at passage 4 were then incubated in the virus-containing medium for 48 hours.
Opti-MEM was used to form a transfection complex containing fugenHD (Promega, Madison, WI, USA) and packaging plasmids, before dropwise addition to the cells. The suspension was then incubated for 12-16 hours and replaced with DMEM supplemented with 30% FBS for 48 hours. The viruscontaining supernatants were obtained and filtered through a 0.45 μm filter. For infection, 500 μL virus-containing supernatants, 500 μL complete medium, and polybrene (final concentration: 8 μg/mL) were added. HUVECs at passage 4 were then incubated in the virus-containing medium for 48 hours.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!