Z1 axioobserver inverted fluorescence microscope

Trypanosome-microglia interaction was initially evaluated microscopically after 2 and 16 h of co-incubation at a 1:30 microglia to parasite ratio. Briefly, after sorting, microglia were allowed to adhere to Millicell® EZ SLIDES (Merck Chemicals GmbH, Darmstadt, Germany) for at least 2 h in DMEM medium without serum. Thereafter, DMEN medium was removed and the TbCMF22-RNAi parasite suspension in HMI-9 medium was added. After different incubation times, medium containing non-adherent cells (trypanosomes and some microglia) was removed, wells were washed twice with PBS. Cells were fixed in 4% paraformaldehyde for 1 h at 4 °C and stained with DAPI for 10 minutes (0.1 mg/ml final concentration). Finally, after removing the grid, slides were covered with Fluoromount G and examined using a Zeiss Z1 AxioObserver inverted fluorescence microscope.

SMB parasites were stable transfected by electroporation with the construct p2T7Ablue-TbCMF22RNAi, which contains a fragment from the 3′UTR region of the Tbcmf22 gene^{21 (link)} cloned in between the 2 T7 promotors using a homologous recombination approach according to the InFusion Cloning Kit® (ClonTech, Nederland) instructions. The plasmid was amplified using the forward primer 5′CGGATCCACTAGTTCTAGAGCGG′3 and the reverse primer 5′TTAACTCGAGGGGGGGCC′3 in order to remove the lacZ sequence. Amplification of the insert included, besides the insert specific sequence (underlined), a plasmid specific sequence important for homologous recombination. Positive clones were analysed by double digestion using XhoI and BamHI restriction enzymes and their identity was confirmed by sequencing. Parasites were then electroporated with 10 µg of the NotI linearized p2T7blue-CMF22RNAi construct and incubated for 5–8 days under hygromycin pressure (2.5 µg/ml) for selection. RNAi induction was performed by addition of 2 µg/ml tetracycline to the culture medium for 72 h. Mutant parasites were confirmed by their diminished translocation capacity as compared to control parasites bearing only the vector. To analyse the phenotype of induced parasites, the translocation capacity was video monitored using a Zeiss Z1 AxioObserver inverted fluorescence microscope.