Pcr buffer with mgcl2

For each sample, we performed three separate 10 μL PCR reactions to reduce PCR bias (Sickel et al., 2015 (link)) using the primers ITS2F [ATGCGATACTTGGTGTGAAT; Tm 61°C (Chen et al., 2010 (link))] and ITS4R [TCCTCCGCTTATTGATATGC; Tm 60°C (White et al., 1990 (link))]. Each reaction contained 0.3 μL FastStartTaq Polymerase (5 U/μL, Roche, Mannheim, Germany), 0.5 μL dNTPs (0.5 mM), 0.75 μL of each forward and reverse primer (10 pmol/μL), 2.5 μL 10× PCR buffer with MgCl₂ at a concentration of 20 mM (Roche, Mannheim, Germany), 19.2 μL PCR grade water, and 1 μL DNA template. The PCR conditions were optimized to the following conditions: initial denaturation at 95°C for 10 min, 37 cycles of denaturation at 95°C for 40 s, annealing at 49°C for 40 s, and elongation at 72°C for 40 s. Final extension was performed at 72°C for 5 min.
All reactions were checked for successful amplifications and contaminations by gel electrophoresis (1.5% agarose gels stained with ethidium bromide, 120 V for 30 min). Triplicate PCR products were pooled per sample and purified using the QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany).

All knock-out mice used in experiments or as donors for adoptive transfers were genotyped at 3–4 weeks of age. At this time, all mice were ear-tagged (National Band & Tag, Newport, KY) and 3–5 millimeter tail snips were collected for genotyping. DNA was extracted using a Qiagen DNeasy DNA extraction kit (Valencia, CA) per manufacturer's protocol. The resulting DNA was used in PCR reactions to determine each individual mouse's genotype. Each reaction contained 0.2 μl FastStart Taq (5 U/μl) (Roche, Indianapolis, IN), 0.3 μl of each 25 μM primer (IDT Coralville, IA), 3.2 μl of 1.25 mM dNTPs (Roche) and 2 μl 10× PCR buffer with MgCl₂ (Roche). Thermal cycling conditions were: 1 cycle at 94°C for 4 min, 45 cycles of 15 at 94°C, 45 sec at the appropriate annealing temperature (Table 1), 1 min at 72°C and 1 cycle at 72°C for 10 min. PCR reactions were analyzed by gel electrophoresis with 3% 1× TBE agarose gels and amplicons were visualized with ethidium bromide (Bio-rad Hercules, CA). Primer sequences and annealing temperatures are listed in Table 1.