For immunofluorescence staining with C2C12 myoblast and myotubes, 4-well Permanox Chamber Slides (Nunc™ Lab-Tek™ Chamber Slide System 177437, Thermo Fisher) were used for Olympus confocal imaging, and Greiner CELLSTAR® 96 well plates (Greiner 655090, Sigma) were used for Yokogawa CV7000 microscope. Cells were seeded on the plates/slides that were pre-treated with 0.3% gelatin, and kept in incubator for proliferation and differentiation. Cells were rinsed with PBS three times and then fixed with 4% PFA in PBS for 15 min at room temperature. After fixation, cells were rinsed twice with PBS before permeabilization with 0.25% Triton X-100 in PBS for 10 min. Next, cells were blocked with freshly made 5% normal donkey serum (or 5% goat serum) in PBST (PBS with 0.25% Triton X-100) for 1 h at room temperature, and were incubated with primary antibody in blocking solution overnight at 4 °C. The next day, after three washes with PBS, cells were incubated with secondary antibody in PBS for 1 h in dark at room temperature. After three washes with PBS, the cells were mounted in VECTASHIELD® Antifade Mounting Medium with DAPI (H-1200-10).
Cellstar 96 well plate
Manufactured by Greiner
Sourced in Germany, Austria
The CELLSTAR® 96 well plates are a type of laboratory equipment used for various cell culture applications. They provide a standardized multi-well format for conducting experiments and assays involving cells, tissues, or other biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax, by Thermo Fisher Scientific (6 mentions)
Hiperfect, by Qiagen (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Prism v8, by GraphPad (1 mentions)
Celltitre 96 aqueous one solution cell proliferation assay, by Promega (1 mentions)
Diamide, by Merck Group (1 mentions)
Operetta high content imaging system, by PerkinElmer (1 mentions)
Silencer select sirna, by Thermo Fisher Scientific (1 mentions)
Hiperfect reagent, by Qiagen (1 mentions)
Coelenterazine h, by Promega (1 mentions)
Wallac victor2 plate reader, by PerkinElmer (1 mentions)
Horseradish peroxidase hrp conjugated rabbit anti mouse igg, by Abcam (1 mentions)
In cell analyzer 2000, by GE Healthcare (1 mentions)
In cell analyzer software, by GE Healthcare (1 mentions)
Ambion silencer select sirna, by Thermo Fisher Scientific (1 mentions)
Negative silencer select control neg1, by Thermo Fisher Scientific (1 mentions)
Celltiter glo ctg luminescent cell viability assay, by Promega (1 mentions)
Fetal calf serum (fcs), by Thermo Fisher Scientific (1 mentions)
Fluorobrite dmem medium, by Thermo Fisher Scientific (1 mentions)
26 protocols using cellstar 96 well plate
1
Immunofluorescence Staining of C2C12 Myoblasts and Myotubes
2
Cytotoxicity Assay for MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-MB-231 cells were seeded at a density of 7500 cells per well (final volume 90 μL) into Greiner CELLSTAR 96-well plates (Greiner Bio-One, 655180) and incubated for ~24 h. On the day of treatment, respective compounds were serially diluted using a semi-logarithmic dilution series from 20 mM stocks in neat DMSO into DMEM-high glucose media (10% v/v FBS) in a separate 96-well plate and under sterile conditions. Thereafter, 10 μL of the diluted compounds at their respective concentrations (n = 4) were added to the cells. DMSO was present in all wells at a final concentration of 0.25% v/v. Vehicle media blanks or drug blanks were also included to correct for inherent colour of the compounds and phenol red-containing media. Following 48 h treatment, 20 μL CellTitre 96® Aqueous One Solution Cell Proliferation Assay (Promega, Madison, USA) was added to each well, plates were incubated for 2 h, and absorbance was measured at 490 nm using a SpectraMax Plus 384-well plate reader (Molecular Devices LLC, San Jose, USA) and Softmax PRO v7.0 software. Blank-corrected data were analysed and graphed using GraphPad PRISM v8.0 software (GraphPad Software, San Diego, CA USA).
3
Real-Time GSH Dynamics Monitoring
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human MSCs were plated into Greiner CELLSTAR 96-well plates (#655090, Greiner Bio-One, Kremsmünster, Austria) at a density of 1 × 103 cells per well. Following further incubation for 12 hours, the cells were labeled in the culture media containing 2 μM FreSHtracer (Cell2in Inc., Seoul, Korea) at 37°C in 5% CO2 incubator for 2 hours. Time-lapse imaging of the cells was recorded from 3 min before to 45 min after treatment of 200 μM diamide (Sigma-Aldrich) using the Operetta High-Content Imaging System (HH12000000, PerkinElmer, Waltham, MA, USA) with ×200 or ×400 magnifications. Fluorescence emissions were detected at 510 and 580 nm, exciting at 430 and 520 nm, respectively, to obtain the FR values of FreSHtracer (18 ). The fluorescence signals were analyzed using Harmony High-Content Imaging and Analysis Software 3.1 (PerkinElmer) with confocal mode. Values for GSH dynamics index (GI) and related initial FR (for baseline of total GSH) and slope after diamide treatment (for GRC) for each plot are presented in data file S3.
4
siRNA Knockdown of DNA Repair Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Duplex siRNA transfections were performed for 72 h with Ambion Silencer Select siRNAs using Lipofectamine RNAiMAX (Thermo Fisher Scientific). The following Silencer Select siRNAs were used at a final concentration of 25 nM: PARP1 (s1098), PARP2 (s19504), PARP3 (s19507), FANCD2 (s4988), BRCA1 (s459), BRCA2 (s2085). PARG knockdown (s16158) was performed for 36 h at a final concentration of 5 nM. When several siRNAs were combined, the final siRNA concentration was kept constant at 25 nM for all conditions. Negative control (s813) from Ambion was used as a non-targeting control and is abbreviated siCon. The siRNA-based screen was performed by reverse-transfection of U-2 OS cells cultured in CELLSTAR 96-well-plates (Greiner Bio-One) for 48 h at a cell density of 6000 cells per well at the time of transfection with Ambion Silencer Select siRNAs at a final concentration of 5 nM using HiPerFect (Qiagen) reagent.
5
Linc-MYH and INO80 Interaction Visualization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Interaction between linc‐MYH and INO80 was confirmed using the rISH‐PLA assay (Roussis et al, 2017 ). Five biotinylated 2′‐O‐Methyl RNA oligonucleotides against linc‐MYH were designed using the Stellaris design tool (https://www.biosearchtech.com/support/education/stellaris-rna-fish : [Btn]GCCATTTGGTATACAGTCTGC[mA][mC][mG][mU], [Btn]CTCGTTGTCAGTTCTGTATAGACCC[mA][mC][mG][mU], [Btn]CATTAGCTGTGGCTACATTA[mA][mG][mU][mC], [Btn]AGATTAGGGATGCTGCCTTG[mA][mC][mG][mU], [Btn]TGTCACTGGGGACTCAATAC[mA][mC][mG][mU]), anti‐biotin antibody (Abcam #ab53494) and an anti‐V5 tag antibody (Thermo Scientific; 37‐7500) was used in the assay. The assay was performed as described using freshly isolated MuSCs grown on Greiner CELLSTAR® 96‐well plates (Greiner #M0562‐32EA) until the cells reached proliferating stage (72 h). The growth medium was removed, and the cells were fixed using 4% paraformaldehyde for seven minutes.
6
QIBC-based siRNA Screening in U2OS Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The QIBC-based siRNA screen was performed by reverse transfection of U2OS cells in CELLSTAR 96-well plates (Greiner Bio-One) for 48 h at a cell density of 5000 cells per well at the time of transfection with Ambion Silencer Select siRNAs at a final concentration of 5 nM using HiPerFect reagent (Qiagen).
Individual siRNA transfections were performed using Lipofectamine RNAiMAX (ThermoFisher Scientific) at a concentration of 10 nM (Ambion Silencer Select) or 40 nM (Microsynth AG) according to manufacturer’s instruction and experiments performed between 48 and 72 h post transfection as indicated.
The oligonucleotides used for individual assays in this study are presented in Supplementary Table2 . Unless stated otherwise in the Figure legend siCtrl (as negative siRNA control), siRAD51C #2, siRAD51D #1, and XRCC3 #1 have been used.
Individual siRNA transfections were performed using Lipofectamine RNAiMAX (ThermoFisher Scientific) at a concentration of 10 nM (Ambion Silencer Select) or 40 nM (Microsynth AG) according to manufacturer’s instruction and experiments performed between 48 and 72 h post transfection as indicated.
The oligonucleotides used for individual assays in this study are presented in Supplementary Table
7
MTS Assay for Cell Viability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell proliferation and viability were determined using the MTS assay. The indicated cells were embedded in CELLSTAR 96‐well plates (Greiner Bio‐One, Frickenhausen, Germany). Forty‐eight hours after incubation, the cells were mixed with MTS reagent. The measurements were conducted according to the manufacturer's instructions.
8
Screening Jackdaws for WNV Exposure
9
Bioluminescence Assay for Octopamine and Tyramine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293/CNG cells were harvested with PBS-EDTA solution and placed in working bovine serum albumen (BSA) medium (DMEM/F-12 with 1% BSA and 1% penicillin and streptomycin). The cells were incubated in coelenterazine h (Promega, Madison, WI, USA) to a final concentration of 5 μM with stirring in the dark for at least 3 h. Before running the bioluminescence assay, the cells were diluted by 5-fold using the BSA medium. For the dose-response curves, stock solutions of D, L-octopamine hydrochloride and tyramine hydrochloride were diluted in BSA medium and tested in triplicate in flat bottom CELLSTAR 96 well-plates (Greiner Bio-One, Kremsmunster, Austria). Using an automated injector, 50 μL of cells were loaded into each well and luminescence was measured over three intervals for 15 s using a Wallac Victor2 plate reader (Perkin Elmer, San Diego, CA, USA). The agonists, serotonin and dopamine, were tested in a similar manner as above. For the antagonists assay, octopamine or tyramine were loaded into the wells along with each antagonist, all dissolved in BSA medium. The plate was then vortexed for 2 min before running the assay.
10
Enzyme-Linked Immunosorbent Assay for Virus Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The viruses were diluted to 1000 HAU/mL with 50 mM bicarbonate/carbonate coating buffer (pH 9.6) (hemagglutinin assay unit) and 100 µL/well was added to a 96-well plate (Greiner CELLSTAR® 96 well plates, Seoul, Korea) and maintained at 37 °C for 2 h. The plate was washed five times with 200 μL PBS and 0.1% Tween 20 (PBS-T, pH 7.4) and then blocked with 5% non-fat dry milk at 37 °C, over 2 h. The primary antibody (5 μg/100 μL/well) and the positive control (anti-influenza A NP, 2 μg/100 μL/well) were then added to each well and incubated for 1 h at 37 °C to detect each virus subtype. The secondary antibody, in the form of horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG (Abcam, Cambridge, UK), was then added to each well, according to the manufacture’s protocol. Stringent washing with PBS-T was performed five times to remove any nonspecific binding and 100 μL 3,3′,5,5′-tetra methyl benzidine (Sigma-Aldrich) substrate solution was added. After 10 min, 100 µL of 0.18 M sulfuric acid was added to stop the reaction. The optical density (OD) was measured at 450 nm by an ELISA plate reader [26 (link),51 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!