Fermentas k1622 revertaid first strand cdna synthesis kit

Total RNA was isolated using SuperEnhanced TRIzol reagent (Sangon Biotech, Shanghai, China) and reverse transcribed into cDNA using a Fermentas K1622 RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Rockford, IL, USA). PCRs were run using FastStart Universal SYBR Green Master (ROX) (Roche, Mannheim, German) on an ABI StepOnePlus qPCR system (Applied Biosystems, Foster, CA, USA). Each sample was tested in triplicate. The relative fold change in gene expression was calculated by the
2-ΔΔCtmethod. Primer sequences were as follows: GAPDH, forward 5′‐CTCTGCTCCTCCTGTTCGAC‐3′ and reverse 5′‐TTAAAAGCAGCCCTGGTGAC‐3′ (104 bp); CNOT7, forward 5′‐GAGGAAGCCAACAAGCAGTC‐3′ and reverse 5′‐GTTCGAGGGATTCAACCAGA‐3 (105 bp); STAT1, forward 5′‐CCGTTTTCATGACCTCCTGT‐3′ and reverse 5′‐TGAATATTCCCCGACTGAGC‐3 (228 bp); caspase‐3, forward 5′‐CTGCCGGAGTCTGACTGGAA‐3′ and reverse 5′‐ATCAGTCCCACTGTCTGTCTCAATG‐3′ (97 bp); TGF‐β1, forward 5′‐GGGGTACCCCAGATGGAGAGAGGACTG‐3′ and reverse 5′‐CCCAAGCTTGGGCAGTCTTGGCTGGGTGCG‐3′ (103 bp); NF‐κb p65, forward 5′‐GGCCATGGACGAACTGTTCCC‐3′ and reverse 5′‐GGAGGGTCCTTGGTGACCAG‐3′ (256 bp).

Total RNA was isolated from cells using TRIzol reagent (TaKaRa). Reverse transcription was performed using the PrimeScript RT Reagent Kit (TaKaRa) and gDNA Eraser (Perfect Real Time) or Fermentas K1622 RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturers' instructions. qRT-PCR was performed using the SYBR Premix Ex Taq (Tli RNase H Plus) system on an ABI Step One Plus machine (Applied Biosystems). The experiments were performed in triplicate, and the values were normalized to that of U6 snRNA. The primer sequences were included in Supplementary Table 6.