Total RNA from tissues was extracted using a miRcute miRNA isolation kit (TIANGEN, Inc.). Total RNA was reverse-transcribed into cDNA using a FastKing RT kit (TIANGEN, Inc.) according to the manufacturer’s protocol. qPCR was subsequently performed on an ABI 7500 real-time PCR system (Applied Biosystems, Thermo Fisher Scientific, Inc.) with a SuperReal PreMix Plus (SYBR Green) reagent (TIANGEN, Inc.). qPCR was performed as follows: 95°C for 15 min, and 40 cycles of 95°C for 10 s and 60°C for 32 s. The primer sequences used for the qPCR are listed in Table S2
Superreal premix plus sybr green reagent
Manufactured by Tiangen Biotech
Sourced in China
SuperReal PreMix Plus (SYBR Green) is a ready-to-use reagent for quantitative real-time PCR (qPCR) applications. It contains SYBR Green I dye, thermostable DNA polymerase, dNTPs, and optimized buffer components. The reagent is designed to provide robust and reliable performance in qPCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Fastquant rt kit, by Tiangen Biotech (3 mentions)
Fastking rt kit, by Tiangen Biotech (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Mircute mirna isolation kit, by Tiangen Biotech (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Prime script rt master mix reagent, by Takara Bio (1 mentions)
Trnzol a reagent, by Tiangen Biotech (1 mentions)
An371, by Beyotime (1 mentions)
β actin af0003, by Beyotime (1 mentions)
Af7569, by Beyotime (1 mentions)
Myiq real time pcr detection system, by Bio-Rad (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Rnaprep plant kit, by Tiangen Biotech (1 mentions)
7 protocols using superreal premix plus sybr green reagent
1
Quantifying mRNA Expression Using qPCR
2
Quantitative Real-Time PCR Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the frozen tissues with RNAiso Plus reagent (Takara, Dalian, China), and then reverse transcribed using PrimeScript™ RT Master Mix reagent (Takara, Dalian, China). The qPCR experiment was conducted using SuperReal PreMix Plus (SYBR Green) reagent (Tiangen, Beijing, China) in the CFX96™ Real-Time PCR Detection system (Bio-Rad, Hercules, CA, USA). The gene GAPDH was selected as the internal reference gene. The expression of all genes was measured by Ct value and normalized with the healthy control group. Primers used for qPCR detection come from the data published by PrimerBank (Table 2 ).
3
Caco-2 Cells Permeability Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Caco-2 cells (purchased from China National Collection of Authenticated Cell Cultures, SCSP-5027) were a gift obtained from Professor Xian-qiong Zou, School of Biotechnology, Guilin Medical University. Sinapic acid (SA) was obtained from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). Nonessential amino acid (NEAA) solution and LPS were obtained from Solarbio Life Sciences Co., Ltd. (Beijing, China). TRNzol-A+ reagent, FastQuant RT Kit, and SuperReal PreMix Plus (SYBR Green) reagent were obtained from Tiangen Biotech Co., Ltd. (Beijing, China). Triton X-100, fix solution (4% paraformaldehyde), bovine serum albumin (BSA), goat serum (C0265), and other reagents were obtained from Beyotime Biotechnology Co., Ltd. (Shanghai, China). Primary antibodies against ZO-1 (AF8394), occludin (AF7644), claudin-1 (AF6504), NF-κB (AF7569), phospho-NF-κBp65 (AN371), phospho-IκBα (Ser32) (AF5851), phospho-IKKα/β (Ser176/180) (AI139), MyD88 (AF2116), TLR4 (AF8187), and β-actin (AF0003) were purchased from Beyotime Biotechnology Co., Ltd.
4
NAA-Treated Seedling RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the roots of eight-day-old seedlings (some of which had been treated with 10 μM naphthalene acetic acid (NAA), obtained from Sigma (St. Louis, MO, USA)) using a TIANGEN Biotech (Beijing) Co. RNA simple Total RNA kit (www.tiangen.com ), following the manufacturer’s protocol. A 2 μg aliquot of the RNA was used as the template for synthesizing the first cDNA strand, using a Fast Quant RT Kit (TIANGEN Biotech (Beijing) Co.). Subsequent qPCRs were processed on an MyiQ Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA), using the Super Real PreMix Plus SYBR Green reagent (TIANGEN Biotech (Beijing) Co.). Each sample was represented by three biological replicates, and each biological replicate by three technical replicates. The AtACTIN2 (At3g18780) sequence was used as the reference. Details of the relevant primer sequences are given in S3 Table .
5
Quantitative gene expression analysis in rat spleen
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the rat spleens with TRIzol® reagent (Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using the FastKing RT Kit (Tiangen Biotech Co., Ltd.) according to the manufacturer's protocol. qPCR was performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.) with SuperReal PreMix Plus SYBR Green reagent (Tiangen Biotech Co., Ltd.). The primer sequences used for qPCR were as follows: β-actin forward (F), 5'-CTGTCCCTGTATGCCTCTG-3' and reverse (R), 5'-ATGTCACGCACGATTTCC-3'; EPO F, 5'-GGGGGTGCCCGAACG-3' and R, 5'-GGCCCCCAGAATATCACTGC-3'; TPO F, 5'-GAACCCAGCTTCCTCCACAG-3' and R, 5'-CCTTTCCCCGAAGCAGTTGT-3'; GM-CSF F, 5'-TCCTAAATGACATGCGTGCT-3' and R, GCCATTGAGTTTGGTGAGGT; IL-4 F, 5'-CTTGCTGTCACCCTGTTC-3' and R, 5'-CATGGAAGTGCAGGACTGC-3'; IL-6 F, 5'-GAGTTCCGTTTCTACCTG-3' and R, 5'-CTCTGGCTTTGTCTTTCT-3'; IFN-γ F, 5'-CGTCTTGGTTTTGCAGCTC-3' and R, 5'-ACTCCTTTTCCGCTTCCTT-3'; GATA binding protein 3 (GATA-3) F, 5'-CTGGCTGGATGGCGGCAAAG-3' and R, 5'-TGGGCGGGAAGGTGAAGAG-3'; and T-bet F, 5'-AACCAGTATCCTGTTCCCAGC-3' and R, 5'-TGTCGCCACTGGAAGGATA-3'. The thermocycling conditions were as follows: 95˚C for 15 min, followed by 40 cycles of 95˚C for 10 sec, 55˚C for 20 sec and 72˚C for 30 sec. The transcript levels were quantified and normalized to the internal reference gene β-actin using the 2-IICq method (23 (link)).
6
RT-qPCR Analysis of PLK1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent (Ambion, Lot No. 317110). Two micrograms of RNA was used for reverse transcription to cDNA by reverse transcriptase (YEASEN, catalog No. 11141ES60) following the manufacturer's instructions. cDNA (500 ng) was used for RT-qPCR with SuperReal PreMix Plus (SYBR Green) reagent (TIANGEN, catalog No. #FP205-02). The reaction parameters were as follows: 95°C for 15 min, followed by 45 cycles of ampli cation with three steps: denaturation at 95°C for 10 s, annealing at 55°C for 20 s and extension at 72°C for 30 s. The primer sequences were as follows: human β-actin forward CACCATTGGCAATGAGCGGTTC; human β-actin reverse AGGTCTTTGCGGATGTCCACGT; human PLK1 forward CACCAGCACGTCGTAGGATTC; human PLK1 reverse CCGTAGGTAGTATCGGGCCTC.
7
Analyzing Plant Immune Response to eBL and flg22
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An RNAprep Plant Kit (Tiangen) was used to extract total RNA from plants in the flg22 and eBL plus flg22 treatments; reverse transcription to cDNA was performed with a FastQuant RT Kit (Tiangen) in a liquid medium. The SuperReal PreMix Plus (SYBR green) reagent (Tiangen) was used to perform qPCR. Primers used for qPCR were as follows: At2g11740 In the resting state, BSK1 forms complexes with RLKs in a ligand-independent manner and localizes to AtFlot1-labeled membrane rafts. Ligands trigger BSK1 dissociation from BSK1/RLK complexes. Upon stimulation with eBL, BSK1 largely remains in the rafts, whereas flg22 treatment leads to BSK1 translocation from membrane rafts to non-membrane-raft regions. Pretreatment with eBL inhibits flg22-induced defense responses by inhibiting BSK1 dissociation from the FLS2/BSK1 complex, as well as BSK1 interaction with MAPKKK5 and BSK1 translocation from membrane rafts to non-raft microdomains within the plasma membrane.
forward, 5 0 -TCTATCTGCCAGTACGATGTTC-3 0 , and reverse, 5 0 -ATTTC TGGCAGTAGTACAACCA-3 0 ; FRK1 (AtAt2g19190) forward, 5 0 -TATATG GACACCGCGTATAGTG-3 0 , and reverse, 5 0 -ATAAAACTTTGCGTTA GGGTCG-3 0 ; CPD (At5g05690) forward, 5 0 -CAAGGCTATGTCCCGGT TAC-3 0 , and reverse, 5 0 -GTTTCTGCGTTCTTGTAGTTGG-3 0 ; and SAUR-AC1 (At4g38850) forward, 5 0 -GGCTTT TTTGAGGAGTTTCTTGGG-3 0 , and reverse, 5 0 -GTTTAAGTATGAAACCGGCACCAC-3 0 .
forward, 5 0 -TCTATCTGCCAGTACGATGTTC-3 0 , and reverse, 5 0 -ATTTC TGGCAGTAGTACAACCA-3 0 ; FRK1 (AtAt2g19190) forward, 5 0 -TATATG GACACCGCGTATAGTG-3 0 , and reverse, 5 0 -ATAAAACTTTGCGTTA GGGTCG-3 0 ; CPD (At5g05690) forward, 5 0 -CAAGGCTATGTCCCGGT TAC-3 0 , and reverse, 5 0 -GTTTCTGCGTTCTTGTAGTTGG-3 0 ; and SAUR-AC1 (At4g38850) forward, 5 0 -GGCTTT TTTGAGGAGTTTCTTGGG-3 0 , and reverse, 5 0 -GTTTAAGTATGAAACCGGCACCAC-3 0 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!