Superscript 4 first strand synthesis system kit

Total RNA was extracted from the 24-hour–fed larval CNS. For each experimental sample, 40 brains were pooled in TRIzol, and isolated RNA was reverse transcribed into cDNA using SuperScript IV First-Strand Synthesis System kit (Thermo Fisher Scientific). Quantitative PCR was performed using the iQ SYBR Green Supermix system (Bio-Rad, Hercules, CA, USA). Gapdh1 expression was used as a control. Relative dilp2 and dilp6 mRNA levels for each sample were calculated using the 2-ΔΔCt method after normalizing to Gapdh1 expression. The following primers were used: dilp6 [45 (link)], Gapdh1 [22 (link)], dilp2 forward: ACGAGGTGCTGAGTATGGTGTGCG, and dilp2 reverse: CACTTCGCAGCGGTTCCGATATCG.

The blood samples of proband and his parents were collected using Tempus^™ Blood RNA Tube (SKU #4342792, Invitrogen). Tempus^™ Spin RNA Isolation Kit (4380204, Invitrogen) was used for RNA extraction from whole blood cells of the proband and his parents. One microgram of RNA was reverse transcribed into cDNA using SuperScript^™ IV First‐Strand Synthesis System Kit (Thermo Fisher Scientific, Invitrogen). The primer sequences used for cDNA amplification were 5′‐GAATCAGGACATTCAAGGAGGGA‐3′ (forward, across the junction of exon 16 and exon 17) and 5′‐TTTCCATGCCTCTTCTCCAGG‐3′ (reverse, across the junction of exon 20 and exon 21). The PCR amplification products were analyzed by agarose gel electrophoresis. The purified DNA bands were cloned into pMD19‐T Vector (TaKaRa) and validated by Sanger sequencing.

RNA was extracted using the Qiagen Miniprep RNA extraction kit (Qiagen) and cDNA was synthesized using the superscript™ IV, first strand synthesis system kit (ThermoFisher Scientific, USA). For real-time PCR, we used the SYBR Green-based detection system (GoTaq qPCR Master Mix, Wisconsin, USA) and amplification was detected using Quant Studio 7 system (Applied Biosystems, CA, USA) in triplicate for each protocol. Average Ct values for each protocol were normalized to average Ct for P1-ND and fold-change in gene expression for each protocol was determined with respect to P1-ND. Primer details are listed in Table 2.Table 2

Primer sequences for real-time polymerase chain reaction

Gene	Primer sequence
PDX1	5’-CGTCCAGCTGCCTTTCCCAT-3’
	5’-CCGTGAGATGTACTTGTTGAATAGGA-3’
NKX6.1	5’-GGGCTCGTTTGGCCTATTCGTT-3’
	5’-CCACTTGGTCCGGCGGTTCT-3’
SOX9	5’-GACTACACCGACCACCAGAACTCC-3’
	5’-GTCTGCGGGATGGAAGGGA-3’
FOXA2	5’-GGGAGCGGTGAAGATGGA-3’
	5’-TCATGTTGCTCACGGAGGAGTA-3’
HNF6	5’-GGACCTCAAGATAGCAGGTTTAT-3’
	5’-CAGAATGCAGGTGAGCTAAGT-3’
HNF1β	5’-ACACACCTCCCATCCTCAAG-3’
	5’-CATTTTAGCAGCCCTCCAAG-3’
NGN3	5’-GGCTGTGGGTGCTAAGGGTAAG-3’
	5’-CAGGGAGAAGCAGAAGGAACAA-3’
NEUROD1	5’-GCCCCAGGGTTATGAGACTAT-3’
	5’-GAGAACTGAGACACTCGTCTGT-3’
NKX2.2	5’-GGCCTTCAGTACTCCCTGCA-3’
	5’-GGGACTTGGAGCTTGAGTCCT-3’
AFP	5’-ACAGAGGAACAACTTGAGGCTGTC-3’
	5’-AGCAAAGCAGACTTCCTGTTCCTG-3’
ALB	5’-GTGAAACACAAGCCCAAGGCAACA-3’
	5’-TCAGCCTTGCAGCACTTCTCTACA-3’

Following the manufacturer's instructions, total RNA was extracted from frozen liver tissues or primary cells using NucleoSpin^® RNA kit (Macherey‐Nagel, Düren, Germany) and reverse‐transcribed into cDNA using a SuperScript™ IV First‐Strand Synthesis System Kit (Thermo Fisher, Waltham, MA, USA). Quantitative real‐time PCR was performed using Fast SYBR™ Green Master Mix (Thermo Fisher, Waltham, MA, USA) to determine the expression levels of target genes, and the results were normalized against to GAPDH expression. Amplification was performed in a StepOne Real‐Time PCR systems (Applied Biosystems, Grand Island, NY, USA). The cycling conditions were: hot‐start activation at 95°C for 20 seconds, followed by 40 cycles of denaturation at 95°C for 3 seconds and annealing/extension at 60°C for 30 seconds, respectively. The following primers were used in this study: GAPDH (5′‐GAACATCATCCCTGCATCCA‐3′ and 5′‐GCCAGTGAGCTTCCCGTTCA‐3′), Bax (5′‐TGAGCGAGTGTCTCCGGCGAAT‐3′ and 5′‐GCACTTTAGTGCACAGGGCCTTG‐3′), Bcl‐2 (5′‐TGGTGGACAACATCGCCCTGTG‐3′ and 5′‐GGTCGCATGCTGGGGCCATATA‐3′), TNF‐α (5′‐CATCTTCTCAAAATTCGAGTGACAA‐3′ and 5′‐TGGGAGTAGACAAGGTACAACCC‐3′), and IL‐6 (5′‐AGTTGCCTTCTTGGGACTGA‐3′ and 5′‐TCCACGATTTCCCAGAGAAC‐3′).

Tempus^TM Blood RNA Tube (Thermo Fisher Scientific, MA, United States) and Tempus^TM Spin RNA Isolation Kit (Thermo Fisher Scientific, MA, United States) were used for blood collection and RNA extraction, respectively. SuperScript IV First-Strand Synthesis System Kit (Thermo Fisher Scientific, MA, United States) was used for reverse transcription. The forward primer (5′-CCGAGTCCACCTGCAAAGAA-3′) used for cDNA amplification crossed the junction of exon 1 and exon 2, while the reverse primer (5′-TTCTCCCCCTCCGTCTCAAT-3′) was located at the beginning of exon 8. For qPCR, the primers of MKS1 5′-AAGGTGGCTCACTTCTCCTACC-3′ and 5′-AGAGGACCTCACAGTAGAGCAC-3′ and the primers of GAPDH 5′-GTCTCCTCTGACTTCAACAGCG-3′ and 5′-ACCACCCTGTTGCTGTAGCCAA-3′ were used.

Total RNA was isolated from the differentiated cells using Direct-zol RNA Purification kit (Zymo Research, USA) following the manufacturer’s recommendations. Superscript™ IV, first-strand synthesis system kit (Thermo Fisher Scientific) was used to synthesize the cDNAs. PCR-Master mix (2×) from (Thermo Fisher Scientific) was used for conventional PCR. The list of primers used are listed in Supplementary Table 2. The RT-PCR products were analyzed by agarose gel electrophoresis. For quantitative RT-PCR (qRT-PCR), SYBR Green-based detection system (GoTaq qPCR Master Mix, Wisconsin, USA) was used to quantify the expression level of mRNA levels. Relative quantification was performed using the comparative ΔΔCT method for each transcript. The experiment was performed using QuantStudio 7 Flex system (Applied Biosystems, CA, USA).

Fly intestines were dissected and transferred to cold phosphate-buffered saline (PBS) buffer. A total of 40 intestines were homogenized with TRIzol reagent (Thermo Fisher, Waltham, MA), and RNA was extracted as previously described [29 (link)]. Ten micrograms of total RNA were reversely transcribed using SuperScript IV First-Strand Synthesis System Kit (Thermo Fisher). The primer sequences are shown in Additional file 2: Table S2. Gene expressions were assessed using a Light Cycler 96 (Roche, Basel, Switzerland). The ΔCt method was used to analyze data, using rp49 as the reference gene. The relative expression values were calculated using the following formula: ΔCt = Ct (target gene)—Ct (reference gene), and the relative expression was equal to 2^−ΔΔCt.