In situ DIG labeled riboprobe was made following the DIG RNA labeling kit protocol (Roche) generated from an IMAGE consortium (Lawrence Livermore National Laboratory) cDNA clone: csf1r (GenBank BC043054, Mammalian Gene Collection, NIH) in the pYX-ASC plasmid vector. In situ hybridization was performed as previously described [41 ] and following the manufacturer’s protocol accompanying the digoxigenin (DIG)-RNA labeling kit (Roche) and using RNAase free equipment. In short, brain sections were hybridized overnight at 64 °C, washed in 50% formamide/1 × SSC/0.1% Tween-20 at 65 °C, and rinsed in 1 × MABT. Brain sections were incubated overnight at room temperature in diluted alkaline phosphatase (AP)-conjugated anti-DIG antibody (1:2500; Roche) in blocking solution, equilibrated in developing buffer (0.1 M Tris, pH 9.5, 0.1 M NaCl, 0.05 M MgCl2, 0.1% Tween-20, levamisole 0.05%) and developed in NBT + BCIP solution (Roche).
Dig rna labeling kit
Manufactured by Roche
Sourced in Switzerland, Germany, United States, United Kingdom, Canada, Japan
The DIG RNA Labeling Kit is a laboratory product used for the in vitro transcription of labeled RNA probes. It incorporates digoxigenin-labeled nucleotides into the synthesized RNA, enabling their detection in subsequent applications such as Northern blotting, in situ hybridization, and RNase protection assays.
Automatically generated - may contain errors
Lab products found in correlation
Pgem t easy vector, by Promega (39 mentions)
Nbt bcip, by Roche (27 mentions)
Alkaline phosphatase conjugated anti dig antibody, by Roche (23 mentions)
Bm purple, by Roche (12 mentions)
T7 rna polymerase, by Roche (11 mentions)
Nbt bcip solution, by Roche (10 mentions)
Anti digoxigenin antibody, by Roche (9 mentions)
Dig nucleic acid detection kit, by Roche (8 mentions)
Pgem t easy, by Promega (8 mentions)
Blocking reagent, by Roche (7 mentions)
Pcrii topo vector, by Thermo Fisher Scientific (7 mentions)
Rneasy mini kit, by Qiagen (6 mentions)
Dig northern starter kit, by Roche (6 mentions)
Nbt bcip stock solution, by Roche (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Anti dig antibody, by Roche (6 mentions)
Pcrii topo, by Thermo Fisher Scientific (5 mentions)
Fluorescein rna labeling kit, by Roche (5 mentions)
Proteinase k, by Roche (5 mentions)
Anti dig ap antibody, by Roche (5 mentions)
608 protocols using dig rna labeling kit
1
In Situ Hybridization of csf1r Gene
2
Comprehensive in situ Hybridization Protocols for Xenopus Kidney Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A DIG RNA labeling kit (Roche) was used to generate digoxigenin-labeled RNA probes for in situ hybridization. Constructs were linearized prior to generating probes using the listed enzyme and polymerase: atp1a1-antisense SmaI/T7 (Eid and Brandli, 2001 (link)), lhx1-antisense XhoI/T7 (Taira et al., 1992 (link); Carroll and Vize, 1999 (link)), hnf1β-antisense SmaI/T7 (Demartis et al., 1994 (link)), nphs1-antisense SmaI/T7 (Gerth et al., 2005 (link)), clcnkb-antisense EcoRI/T7 (Vize, 2003 (link)), slc5a1-antisense SmaI/T7 (Zhou and Vize, 2004 (link)), and pax2-antisense EcoRI/T7 (Carroll and Vize, 1999 (link)).
Digoxigenin-labeled dnmbp RNA probes were generated by first extracting DNA from stage 40 embryos as previously described (Bhattacharya et al., 2015 (link)). Regions of dnmbp.L and dnmbp.S were amplified from embryo DNA by PCR using the following primers: dnmbp.L-sense-Sp6 (5′-CTAGCATTTAGGTGACACTATAGGTCAAAGGACACTCGAAACAC-3′), dnmbp.L-antisense-T7 (5′-CTAGCTAATACGACTCACTATAGAGAAACATTCGTCTCGCGAGG-3′), dnmbp.S-sense-Sp6 (5′-CTAGCATTTAGGTGACACTATAGGTTAAAGGACACTCGAAACAC-3′) and dnmbp.S-antisense-T7 (5′-CTAGCTAATACGACTCACTATAGAGAAACGTTCGTGGAGGGTAC-3′). PCR products were transcribed to create digoxigenin-labeled RNA probes using a DIG RNA labeling kit (Roche) and the appropriate polymerase (T7 or Sp6).
Digoxigenin-labeled dnmbp RNA probes were generated by first extracting DNA from stage 40 embryos as previously described (Bhattacharya et al., 2015 (link)). Regions of dnmbp.L and dnmbp.S were amplified from embryo DNA by PCR using the following primers: dnmbp.L-sense-Sp6 (5′-CTAGCATTTAGGTGACACTATAGGTCAAAGGACACTCGAAACAC-3′), dnmbp.L-antisense-T7 (5′-CTAGCTAATACGACTCACTATAGAGAAACATTCGTCTCGCGAGG-3′), dnmbp.S-sense-Sp6 (5′-CTAGCATTTAGGTGACACTATAGGTTAAAGGACACTCGAAACAC-3′) and dnmbp.S-antisense-T7 (5′-CTAGCTAATACGACTCACTATAGAGAAACGTTCGTGGAGGGTAC-3′). PCR products were transcribed to create digoxigenin-labeled RNA probes using a DIG RNA labeling kit (Roche) and the appropriate polymerase (T7 or Sp6).
3
Zebrafish Transcriptional Profiling by In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zebrafish were collected at 72 hpf, fixed with 4% PFA for 1.5 h at room temperature, and incubated in 100% Methanol at −20 °C for at least 16 h. Dig-labelled anti-sense mRNA probes for whole-mount in situ hybridzation were generated from wild-type cDNA by PCR using a reverse primer containing the T7 promoter sequence. The following PCR primers were used for template generation (5′ to 3′):raldh2-F AACGGGGGAAGCT-ACTGTTCA;raldh2-R GTAATACGACTCACTATAGGGGATTATCTCC-TCCTTGGCGATGC,klf2a-F: ATGGCAGGCGACTACAGAATG-3′;klf2a-R: TGTAATACGACTCACTATAGGGGATCAATGATAGGGCTTCTCGCC;
In vitro transcription was done using the T7 polymerase and the DIG RNA Labeling Kit (Roche). In vitro transcription was done using the T7 polymerase and the DIG RNA Labeling Kit (Roche). In situ hybridization was performed as previously described31 (link), with the exception of probe hybridization at 67 °C. Stained embryos were mounted in Permount32 and images were acquired using an Axioskop microscope (Zeiss) and an EOS 5DMark III camera (Canon). Image processing was done with Fiji and Affinity Designer (Serif Europe).
In vitro transcription was done using the T7 polymerase and the DIG RNA Labeling Kit (Roche). In vitro transcription was done using the T7 polymerase and the DIG RNA Labeling Kit (Roche). In situ hybridization was performed as previously described31 (link), with the exception of probe hybridization at 67 °C. Stained embryos were mounted in Permount32 and images were acquired using an Axioskop microscope (Zeiss) and an EOS 5DMark III camera (Canon). Image processing was done with Fiji and Affinity Designer (Serif Europe).
4
In Situ Hybridization of Olfactory Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the plasmid vector was linearized, digoxigenin (DIG)-labeled antisense and sense cRNA probes were prepared using T7 and SP6 RNA polymerases with a DIG RNA Labeling Kit (Boehringer Mannheim, Mannheim, Germany) in accordance with the manufacturer's instructions. Olfactory rosette tissues were fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.2) at 4 °C for 72 h, and then embedded in Histosec. Then, approximately 5-μm thick sections were prepared. Serial paraffin sections were digested with 20 μg/mL proteinase K in 10 mmol/L Tris-HCl, 1 mmol/L EDTA (pH 8.0) for 20 min at 37 °C, and then treated with 0.2 mol/L HCl for 10 min and 0.25% acetic anhydrate in 0.1 mol/L triethanolamine-HCl (pH 8.0) for 10 min. Hybridization and immunohistochemical detection for hybridized signals were performed using the previously reported method (Kudo et al., 1999 (link)). To assess the specificity of the in situ hybridization signals, two negative control procedures were performed. First, RNA was digested in randomly chosen sections with 20 μg/mL RNase A for 30 min at 37 °C prior to in situ hybridization. Second, digoxygenin-labeled sense RNA probes were hybridized in parallel to antisense RNA probes in all cases.
5
Regulation of TPH1 RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For changes in the levels of TPH1 RNA message, the cells were incubated with either 6-diazo-5-oxo-L-norleucine (DON) (glutamine antagonist), SB203580 (p38 MAPK inhibitor), PD98059 (p42/44 MAPK inhibitor) or wortmannin (PI3K inhibitor) at the indicated concentrations in the figure legends for 6 h with control media. Total RNA was extracted and the RNA (5 µg) was separated by 1% agarose/formaldehyde gel electrophoresis and transferred to a Hybond-N + nylon membrane (Amersham Life Sciences, UK). Digoxigenine (DIG)-labeled RNA probes for Northern blot analysis were synthesized with a DIG RNA Labeling Kit (Boehringer Mannheim). Hybridization of the labeled probes and conjugation with an anti-DIG antibody-alkaline phosphatase complex were carried out with a DIG Nucleic Acid Detection Kit (Boehringer Mannheim) according to the manufacturer. The phosphatase complex on the nylon membrane was visualized with the chemiluminescent substrate CSPD (Boehringer Mannheim) according to the manufacturer’s recommendations.
6
RNA Probe Detection and Visualization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The membrane was prehybridized in UltraHyb buffer (Ambion) for 1-2 h at 65 °C. Blots described were probed with a 149-nt antisense single-stranded RNA complementary to the sense-strand RNA of the v-ATPase C hpRNA labelled with DIG digoxigenin-11-UTP using the Roche DIG RNA labeling Kit (Roche) according to manufacturer’s protocols [12 (link)]. Probes at a concentration of 80 ng/ml of hybridization solution were denatured at 95 °C for 5 min and placed on ice for at least 2 min before adding to fresh hybridization solution. Hybridization occurred overnight at a temperature of 65 °C in hybridization tubes. Following hybridization, the blots were subjected to the DIG immunological washes and detection (DIG wash and block buffer set, Roche) following manufacturer’s instructions. The wrapped blot was put up film for 1-20 min, developed and scanned.
7
In situ Hybridization of Laminin Chain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ hybridization for each laminin chain was performed as described previously [20 (link)]. Briefly, to make complementary RNA (cRNA), DNA fragments were amplified from cDNA of adult rat pituitary using gene-specific primers (for primer information, see [20 (link)]). A BLAST search to verify the specificity of probe sequences confirmed that each probe sequence was specific to the target gene. DNA fragments were ligated into the pGEM-T vector (Promega, Fitchburg, WI, USA) and cloned. Gene-specific antisense or sense digoxigenin (DIG)-labeled cRNA probes were made by using a Roche DIG RNA labeling kit (Roche Diagnostics, Penzberg, Germany). DIG-labeled cRNA probe hybridization was performed at 55°C for 16–18 hr. Each mRNA type was visualized with alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics) by using 4-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics). Sections treated with DIG-labeled sense RNA probes were used as a negative control to confirm probe specificity. No signal was detected in any sense probes. Sections were observed using an AX-80 microscope (Olympus, Tokyo, Japan).
8
Spinal Cord Development: Imaging Molecular Markers
9
In situ Hybridization for Gene Expression Analysis
10
Rat Cyp19a1 mRNA Detection by In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following DNA fragments were amplified from rat cDNA using the polymerase chain
reaction (PCR): Cyp19a1 (GenBank accession no. NM017085; 1824–2309) with
forward (5’- CGA GTA TTT CCC CAA GCC CA-3’) and reverse (5’-TTC TTT TGC ATC CCG GCT CT-3’)
primers. Gene-specific antisense or sense digoxigenin (DIG)-labeled cRNA probes were made
using the Roche DIG RNA labeling kit (Roche Diagnostics Corp., Penzberg, Germany). Gastric
frozen sections (20 µm thick) were obtained in a cryostat (CM3000; Leica,
New York, NY, USA) and were mounted on glass slides with Tissue-Tek O.C.T. Compound
(Sakura Finetek Japan Co., Ltd., Tokyo, Japan). Then DIG-labeled cRNA probe hybridization
was performed in a solution containing 50% formamide, 10% dextran sulfate (Wako Pure
Chemical Industries Ltd., Osaka, Japan), 3× standard sodium citrate, 120 mM phosphate
buffer (pH 7.4), 1× Denhardt solution (Nacalai Tesque Inc., Kyoto, Japan), 125
µg/ml tRNA (Thermo Fisher Scientific Inc.), and 100
µg/ml sonicated sperm DNA (Thermo Fisher Scientific Inc.) at 60°C for
16–18 h. Visualization of mRNA was performed with alkaline-phosphatase-conjugated anti-DIG
antibody (Roche Diagnostics Corp.) using 4-nitroblue tetrazolium chloride and
5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics Corp.). Control experiments were
performed. No specific signals were detected in sections processed with DIG-labeled sense
RNA probes.
reaction (PCR): Cyp19a1 (GenBank accession no. NM017085; 1824–2309) with
forward (5’- CGA GTA TTT CCC CAA GCC CA-3’) and reverse (5’-TTC TTT TGC ATC CCG GCT CT-3’)
primers. Gene-specific antisense or sense digoxigenin (DIG)-labeled cRNA probes were made
using the Roche DIG RNA labeling kit (Roche Diagnostics Corp., Penzberg, Germany). Gastric
frozen sections (20 µm thick) were obtained in a cryostat (CM3000; Leica,
New York, NY, USA) and were mounted on glass slides with Tissue-Tek O.C.T. Compound
(Sakura Finetek Japan Co., Ltd., Tokyo, Japan). Then DIG-labeled cRNA probe hybridization
was performed in a solution containing 50% formamide, 10% dextran sulfate (Wako Pure
Chemical Industries Ltd., Osaka, Japan), 3× standard sodium citrate, 120 mM phosphate
buffer (pH 7.4), 1× Denhardt solution (Nacalai Tesque Inc., Kyoto, Japan), 125
µg/ml tRNA (Thermo Fisher Scientific Inc.), and 100
µg/ml sonicated sperm DNA (Thermo Fisher Scientific Inc.) at 60°C for
16–18 h. Visualization of mRNA was performed with alkaline-phosphatase-conjugated anti-DIG
antibody (Roche Diagnostics Corp.) using 4-nitroblue tetrazolium chloride and
5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics Corp.). Control experiments were
performed. No specific signals were detected in sections processed with DIG-labeled sense
RNA probes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!