The tracheas and esophagi were isolated from E11.5 wild type embryos. RNA was isolated using the PicoPure RNA Isolation Kit (Thermo Fisher Scientific), and RNA reverse transcription was performed using the SuperScript IV First-Strand Synthesis Kit (Invitrogen) according to the manufacturer’s instructions. cDNA was subjected to quantitative real-time polymerase chain reaction (qPCR) using the StepOnePlus Real-Time PCR Detection System (Applied Biosystems) and iTaq Universal SYBR Green Supermix (Bio-Rad). The primers used for qPCR are listed in the Key Resources Table . The transcript levels of genes were normalized to beta-actin expression. All qPCR experiments were performed in triplicate.
Superscript 4 first strand synthesis kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
The SuperScript IV First-Strand Synthesis kit is a laboratory equipment product used for the synthesis of complementary DNA (cDNA) from RNA templates. It provides a reliable and efficient method for the reverse transcription of RNA into cDNA, which is a critical step in various molecular biology and genomics applications.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (18 mentions)
Trizol, by Thermo Fisher Scientific (17 mentions)
Dnase 1, by Thermo Fisher Scientific (10 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (9 mentions)
Qiaamp viral rna mini kit, by Qiagen (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Rneasy kit, by Qiagen (5 mentions)
Quick rna miniprep kit, by Zymo Research (5 mentions)
Q5 hot start hf taq polymerase, by New England Biolabs (5 mentions)
Taqman probe, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Quantstudio 12k flex real time pcr system, by Thermo Fisher Scientific (4 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (4 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Nebuilder, by New England Biolabs (3 mentions)
Hype5 transfection reagent, by Ozyme (3 mentions)
Swift snap amplicon sars cov2 kit, by Integrated DNA Technologies (3 mentions)
Novaseq sp lane, by Illumina (3 mentions)
Tissuelyser 2, by Qiagen (3 mentions)
96 protocols using superscript 4 first strand synthesis kit
1
Quantifying Gene Expression in Mouse Embryos
2
Quantitative Expression Analysis of Porcine Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells and tissues using an RNeasy Mini Kit (Qiagen, Hilden, Germany). The tissues of wild-type miniature pigs were kindly provided by Dr. Hwang of the Korea Institute of Toxicology. cDNA was synthesized using a Superscript IV First-Strand Synthesis Kit (Invitrogen, Waltham, MA, USA). Real-time quantitative PCR (qPCR) was performed in triplicate using the Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and the StepOne Real-Time PCR system (Applied Biosystems). The sequences of the primers used in the assays are presented in Table 1 . In the porcine cells, ESAM, platelet endothelium activation receptor 1 (PEAR1), and ICAM2 expression values were normalized to the expression of β-actin (ACTB). The gene expression in tissues was normalized using ACTB and porcine 18S ribosomal RNA. Comparative CT (ΔΔCT) quantitation was used to evaluate the relative expression of the genes. ΔΔCT values were determined by analyzing the data using the StepOne software v2.3.
3
Cloning and Expression of Antibody Variable Regions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MAY-115 and MAY-134 variable regions were sequenced and cloned using previously described methods (Ho et al., 2016 (link)). Total RNA was isolated from hybridomas, and cDNA was produced using random hexamers and Oligo(dT)20 using a SuperScript IV First Strand Synthesis kit (Invitrogen). Heavy and light chain variable regions were amplified and sequenced using mouse-specific primer sets (Ho et al., 2016 (link)). Allele-specific primers were used to amplify variable regions and append Gibson assembly sequences to the 5′ and 3′ ends. The variable regions then were cloned into plasmids containing the constant regions of human IgG1 (pAbVec-hIgG1) or mouse IgG1 (pAbVec-mIgG1) or the appropriate kappa chain (pAbVec-hIgKappa or pAbVect-mIgKappa) using NEBuilder (New England Biolabs). The human IgG1-N297Q vector was produced by site-directed mutagenesis of the human IgG1 vector using a Phusion site-directed mutagenesis kit. Antibodies were produced by cotransfecting Expi293 cells with an appropriate heavy and kappa chain plasmid using Hype5 transfection reagent (Oz Biosciences). 4 d after transfection, supernatant was collected and mAbs were purified on a Protein A Agarose column (Pierce).
4
Gene Expression Analysis of Inflammatory and Remodeling Markers
5
RNA Extraction and Real-Time qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using a RNeasy Mini Kit (Qiagen). The cDNAs were synthesized using a Superscript IV First-Strand Synthesis Kit (Invitrogen). Real-time quantitative PCR (qPCR) was performed in triplicate using Power SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA) and a StepOne Real-Time PCR System (Applied Biosystems). Sequences of the primers used are presented in Table 1 .
6
SARS-CoV-2 Genomic Sequencing from Saliva
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from 140 µL of heat-inactivated (30 minutes at 95°C, as part of the protocol detailed in Ranoa et al. [9 (link)]) saliva samples using the QIAamp viral RNA mini kit (QIAGEN); 100 ng of viral RNA was used to generate cDNA using the SuperScript IV first strand synthesis kit (Invitrogen). Viral cDNA was then used to generate sequencing libraries using the Swift SNAP Amplicon SARS CoV2 kit with an additional coverage panel and unique dual indexing (Swift Biosciences), which were sequenced on an Illumina Novaseq SP lane. Data were run through the nf-core/viralrecon workflow (https://nf-co.re/viralrecon/1.1.0 ) using the Wuhan-Hu-1 reference genome (NCBI accession NC_045512.2). Swift, version 2, primer sequences were trimmed before variant analysis from iVar, version 1.3.1 (https://genomebiology.biomedcentral.com/articles/10.1186/s13059-018-1618-7 ), retaining all calls with a minimum allele frequency of 0.01 and higher. Viral lineages were called using the Pangolin tool (https://github.com/cov-lineages/pangolin ), version 2.4.2, pango, version 1.2.6, and the 5/19/21 version of the pangoLEARN model.
7
Heminested RT-PCR for Bat Coronavirus Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The detection of bat coronaviruses was done using heminested reverse-transcription PCR (RT-PCR) with broadly reactive consensus PCR primers targeting the RNA-dependent RNA polymerase (RdRp) gene of different CoVs as previously described [10 (link)]. The synthesis of cDNA was carried out using Superscript IV First-Strand Synthesis kit (Invitrogen) followed by the nested PCR. The amplified product of 328 bp was visualised using 2% agarose gel electrophoresis. The RdRp PCR products were purified using the QIAquickn® Gel and PCR Clean-up kit and sequenced directly using an automated ABI 3500xl DNA Sequencer available at ACEGID.
8
Quantifying Gene Expression in Fly Antennae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antennae from 100 male flies were dissected on CO2 pads and transferred into TRIzol (Ambion Life Technologies). At least three biological replicates were prepared for each genotype. RNA was extracted using the RNeasy kit (QIAGEN) and reverse-transcribed using the SuperScript IV First-Strand Synthesis Kit (Invitrogen). qPCR was performed using the FastStart Universal SYBR Green Master (ROX) kit (Roche) on Eppendorf Realplex. Primers used were listed in Table 1 . The expression level of each gene was normalized to the expression of actin, and the relative expression level was compared across experimental conditions using the delta-delta Ct method. Statistical tests were performed in GraphPad Prism.
9
Quantifying RNA Expression Via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription was performed as mentioned previously [6 (link)]. In brief, RNA was extracted from the biopsies using the EZNA® Total RNA Kit I (Omega BIO-TEK, Norcross, GA, USA). Reverse transcription was carried out using the SuperScript IV First-Strand Synthesis kit (Invitrogen, Carlsbad, CA, USA). The expression of markers was assessed by performing real-time qPCR using a KAPA SYBR FAST Master mix (KAPA BIOSYSTEMS, KK4601) and specific primers according to the manufacturer’s protocol. The fold change expression was calculated by adopting the delta-delta Ct method. The primers used are provided in Supplementary Table S1 .
10
High-Grade Serous Ovarian Carcinoma RNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Six human samples with a definitive diagnosis of high‐grade serous ovarian carcinoma were obtained from the Second Affiliated Hospital of Harbin Medical University (Harbin, China). Total RNA was extracted using a formalin‐fixed paraffin‐embedded (FFPE) sample processing kit according to the manufacturer's protocol (Quantigene, Miami). cDNA was synthesized using the SuperScript™ IV First‐Strand Synthesis kit (Invitrogen). A standard PCR reaction was performed using the following primers: forward primer, GCCTTCTACCAGGGCGCCTAC; reverse primer, ACGTCCATGACCACTGCAATCAC. All patients were informed regarding the purpose of the research and provided informed consent. These experiments were approved by the Ethics Committee of Harbin Medical University.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!