The PCR primers for this assay were previously selected in the single-copy BALF-5 gene encoding the viral DNA polymerase [50 (link)]; the upstream and downstream primer sequences were 5′-CGGAAGCCCTCTGGACTTC-3′ and 5′-CCCTGTTTATCCGATGGAATG-3′, respectively, with a fluorogenic probe (5′-TGTACACGCACGAGAAATGCGCC-3′) with a sequence located between the PCR primers. Detectable DNA from EBV was identified by a real-time PCR assay as previously described [51 (link),52 (link)]. Briefly, DNA from whole blood samples collected in EDTA was extracted using Purogene blood core kit B (Qiagen, Minneapolis, MN, USA). The PCR reaction was performed using a mixture containing 1μL of DNA, 0.2 μM each primer, 0.1 μM fluorogenic probe, and 5 μL of TaqMan Master Mix (PE Applied Biosystems), and the PCR cycle was performed as follows: 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. The TaqMan Master Mix (PE Applied Biosystems) was used for all reactions. For all PCR analyses, water was used as negative control, and B958 and P3HR1 viral DNA were used as positive controls. The B958 and P3HR1 viral strains were kindly provided by Dr. Talita A. F. Monteiro (Federal University of Pará, PA, Brazil) and were described elsewhere [53 (link)]. Samples were defined as negative if the CT values exceeded 40 cycles.
Taqman master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Switzerland, Canada, Belgium
TaqMan Master Mix is a ready-to-use solution designed for real-time PCR applications. It contains all the necessary components for efficient DNA amplification and detection, including a thermostable DNA polymerase, dNTPs, and proprietary buffer system.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (81 mentions)
Rneasy mini kit, by Qiagen (67 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (58 mentions)
Trizol, by Thermo Fisher Scientific (50 mentions)
Taqman probe, by Thermo Fisher Scientific (36 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (35 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (26 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (17 mentions)
Nanodrop, by Thermo Fisher Scientific (16 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (15 mentions)
Rneasy kit, by Qiagen (15 mentions)
Rneasy plus mini kit, by Qiagen (15 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (14 mentions)
Quantitect reverse transcription kit, by Qiagen (14 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (12 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (12 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (12 mentions)
Sybr green master mix, by Thermo Fisher Scientific (11 mentions)
Taqman assay, by Thermo Fisher Scientific (11 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (10 mentions)
448 protocols using taqman master mix
1
Quantitative PCR Detection of EBV
2
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR analysis was performed on a QuantStudio 6 Flex (Applied Biosystems). Briefly, the primer mix for the ribosomal 18 S control gene contained 12.5 µL TaqMan Master Mix (Applied Biosystems), 0.15 µL Ribosomal Probe (life technologies), 0.15 µL Forward Primer (life technologies), 0.15 µL Reverse Primer (life technologies) and 2.05 µL H2O per sample. Ten µL of cDNA (25 ng) were analyzed. For TaqMan® Assays (Applied Biosystems; IL17A (Hs00174383_m1), IL22 (Hs00220944_m1), IL26 (Hs00218189_m1), CCL20 (Hs00171125_m1), CXCL2 (Hs00601975_m1) and CXCL8 (Hs00174103_m1)), 10 µL TaqMan Master Mix and 1 µL primer mix was added. For TLR2 primers (forward: cgttctctcaggtgactgctc, reverse: cctttggatcctgcttgc), 12.5 µL SYBR Green Master Mix and 2.5 µL of a 2 µM primer mix were used.
3
Osteoblast Differentiation and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 7 days of osteoblast differentiation, the Trizol reagent was used for isolating total RNA, 1.0 μg of which was reverse-transcribed using avian myeloblastosis virus reverse transcriptase (Roche).
First-strand complementary DNA (cDNA) was synthesized, and quantitative polymerase chain reaction (qPCR) was performed using 5 ng/μL of cDNA. Quantitative real-time (qRT)-PCR was conducted using primers for ALP, BSP, CBFA1, Col-1, OCN, and VDR. To avoid DNA contamination by signals, forward and reverse sequences of each primer were designed on distinct exons; qPCR was performed using the SYBR Green PCR Master Mix and TaqMan Master Mix (Applied Biosystems) according to manufacturer instructions. Furthermore, the reactions were performed using the ViiA7 Real-Time PCR system (Applied Biosystems) with the TaqMan Master Mix at 50°C for 2 min, followed by 95°C for 10 min, and then 40 cycles each at 95°C for 15 s and 60°C for 60 s. The SYBR use was followed by PCR at 95°C for 10 min and then 40 cycles each at 95°C for 15 s, 60°C for 60 s, and 60°C for 15 min. The Ct values for ALP, BSP, CBFA1, Col-1, VDR, and OCN messenger RNAs (mRNAs) were normalized to the value of the housekeeping gene GAPDH mRNA.
First-strand complementary DNA (cDNA) was synthesized, and quantitative polymerase chain reaction (qPCR) was performed using 5 ng/μL of cDNA. Quantitative real-time (qRT)-PCR was conducted using primers for ALP, BSP, CBFA1, Col-1, OCN, and VDR. To avoid DNA contamination by signals, forward and reverse sequences of each primer were designed on distinct exons; qPCR was performed using the SYBR Green PCR Master Mix and TaqMan Master Mix (Applied Biosystems) according to manufacturer instructions. Furthermore, the reactions were performed using the ViiA7 Real-Time PCR system (Applied Biosystems) with the TaqMan Master Mix at 50°C for 2 min, followed by 95°C for 10 min, and then 40 cycles each at 95°C for 15 s and 60°C for 60 s. The SYBR use was followed by PCR at 95°C for 10 min and then 40 cycles each at 95°C for 15 s, 60°C for 60 s, and 60°C for 15 min. The Ct values for ALP, BSP, CBFA1, Col-1, VDR, and OCN messenger RNAs (mRNAs) were normalized to the value of the housekeeping gene GAPDH mRNA.
4
RNA Quantification and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted with RNA extraction kit (Invitrogen), and quantified at Nanodrop. 100 ng of RNA were retrotranscribed into cDNA using a Reverse-Transcription kit (Life Technologies). qRT-PCR was performed using SYBR Green (Life Technologies) to detect expression of PIP4K2B, and TaqMan Master Mix (Invitrogen) for YAP target genes. GAPDH was used as housekeeping control (primers sequences and probes ID reported in Supplementary Table 5 ).
5
Quantification of lncRNA UBE2R-AS1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNAs were extracted using RNeasy Mimi Kit (QIAGEN). cDNA was synthesized using cDNA Reverse Transcription Kit (Invitrogen, Thermo Fisher Scientific). Quantitative real-time PCR (qRT-PCR) was conducted on a QS6 Fast Real-Time PCR system (Thermo Fisher Scientific) using SYBR Green Master Mix or TaqMan Master Mix (Invitrogen, Thermo Fisher Scientific). The relative expression of lncRNA UBE2R-AS1 was calculated by the 2−ΔΔCt method. Primer sequences used are presented in Table 1 .
6
Quantitative Analysis of MicroRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells and tissues with Trizol reagent (Invitrogen, Calsbad, CA, USA). MicroRNAs were quantitated by real-time PCR using TaqMan MicroRNA assay (Invitrogen, USA). First-strand complementary DNA (cDNA) synthesis was carried out from 1 µg of total RNA in 12 µl of final volume containing 2 M stem-loop primer, 10 mM dNTP Mix (Invitrogen, USA). The mix was plate at 65°C for 5 min, and then mixed with 5×RT buffer, 0.1 M DTT, 200 U/µl MultiScribe reverse transcriptase and 40 U/µl RNase inhibitor (Invitrogen, USA). The mix was plate at 37°C for 55 min, 70°C for 15 min and then held at −20°C. Real-time PCR was performed using a standard TaqMan PCR protocol. The 20 µl PCRs reactions included 1 µl of RT product, 1 Universal TaqMan Master Mix and 1×TaqMan probe/primer mix (Invitrogen, USA, Table 2 ). All RT reactions including no-template controls were run in triplicate. All mRNA quantification data were normalized to U6. The relative amount of transcript was calculated using the comparative Ct method.
7
Cytokine Profiling in Parasite-infected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cytokine profiling, after washing the uninternalized parasite, cells were lysed and total RNA was isolated at 0 min, 15 min, 30 min, 45 min and 60 min post-infection. The total RNA was isolated using TRI Reagent as per the manufacturer’s instructions. The cDNA synthesis was done using 2 μg of total RNA through high Capacity cDNA kit (Invitrogen) as per the manufacturer’s instructions.
Q-PCR was performed on StepOnePlus Real-Time PCR System (Thermo Scientific, Waltham, MA, USA). For each reaction, 5 μL Taqman Master mix (Invitrogen, Waltham, MA, USA), 1 μg cDNA as Template, 0.5 μg Taqman probes (Supplementary Material S8 ) was taken, and the reactions were performed on thin-wall 0.1 mL fast 96 well plate (Applied Biosystems, Waltham, MA, USA) for a total of 10 μL reaction mix. Relative quantitation was done using the comparative threshold (ΔΔCT) method. The mRNA expression levels of the target genes were normalized against those of β actin levels and expressed as relative fold change compared with untreated controls.
Q-PCR was performed on StepOnePlus Real-Time PCR System (Thermo Scientific, Waltham, MA, USA). For each reaction, 5 μL Taqman Master mix (Invitrogen, Waltham, MA, USA), 1 μg cDNA as Template, 0.5 μg Taqman probes (
8
Quantitative PCR for ALIX and CCR2B mRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real-time PCR quantitation of ALIX or ccr2b mRNAs, RNA extracted from HeLa cells (for ALIX) or MDMs, CEM-CCR5 or HeLa cells (for ccr2b) using RNeasy mini kit was quantified via nanodrop and 2 μg RNA was used to synthesize cDNA using Moloney Murine Leukemia Virus RT enzyme. Quantitative PCR was run on 10 ng of cDNA. For ALIX mRNA quantitation, qPCR was performed using 2X Taqman master mix (Applied Biosystems), with cycling conditions was as follows; 50°C for 2 min, 95°C for 2 min, 40 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 1 min. For, ccr2b mRNA, quantitative PCR was run using, 2X PowerUP SYBR Green master mix (5 µL), forward and reverse primers (800 nM each), and nuclease-free water. The cycling condition used was as follows: 50°C for 2 min, 95°C for 2 min, 40 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 1 min. The amplification and CT values were analyzed using QuantStudio Real-Time PCR software v1.3.
9
Immune Checkpoint Gene Expression in HPV+ and HPV- HNC
10
Quantification of Vaccinia Viral Load
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!