Bryostatin 1

Manufactured by Merck Group

Sourced in United States, Germany

Bryostatin-1 is a naturally occurring compound isolated from the marine bryozoan Bugula neritina. It is a complex macrocyclic lactone that has been extensively studied for its potential therapeutic applications. Bryostatin-1 has been shown to modulate the activity of protein kinase C, a key regulator of cellular processes. The core function of Bryostatin-1 is to serve as a research tool for studying cellular signaling pathways and their potential therapeutic implications.

Automatically generated - may contain errors

Lab products found in correlation

Prostratin, by Merck Group (4 mentions) Phorbol myristate acetate (pma), by Merck Group (4 mentions) Tnf α, by R&D Systems (3 mentions) Cycloheximide (chx), by Merck Group (2 mentions) Ril 2, by Thermo Fisher Scientific (2 mentions) Panobinostat, by Selleck Chemicals (2 mentions) G 6983, by Merck Group (2 mentions) Nanodrop one, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Indinavir, by Merck Group (1 mentions) Poly 1 c, by Merck Group (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Revertra ace qpcr rt kit, by Toyobo (1 mentions) Cfx96tm real time system, by Bio-Rad (1 mentions) Rottlerin, by Merck Group (1 mentions) Gf109203x, by Merck Group (1 mentions) Bay11 7082, by Santa Cruz Biotechnology (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Bay 11 7082 b5556, by Merck Group (1 mentions) Antibiotic and antimycotic solution, by Thermo Fisher Scientific (1 mentions)

27 protocols using bryostatin 1

HIV Suppression Assay with Epigenetic Modulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Autologous bulk CD8 + and CD4 + T cells were freshly isolated from PBMCs from elite suppressors as described above (“Primary Cell Isolation”) for a modified version of a previously described HIV suppression assay (Buckheit et al., 2012 (link)). CD8 + T cells were treated for six hours in non-stimulating media (RPMI 1640 + Glutamax, 10% FBS) with either nothing, DMSO, romidepsin (40 nM), JQ1 (1 μM; Sigma Aldrich), vorinostat (335 nM), panobinostat (30 nM), bryostatin-1 at three concentrations (10 nM, 1 nM, 0.1 nM), or prostratin at two concentrations (1 μM, 0.3 μM; Sigma Aldrich) alone or in the combinations of romidepsin and bryostatin-1, romidepsin and prostratin, or bryostatin-1 and JQ1 at those concentrations. Meanwhile, the bulk CD4 + T cells were spinoculated at 1200 × g for two hours at 37 °C with HIV-1_{NL4 − 3 ∆ Env − GFP}, a replication incompetent lab strain pseudovirus with env replaced with gfp and whose expression is controlled by the HIV promoter. At the conclusion of the six-hour drug treatments, the drug was washed from the CD8 + T cells before the cells were added in a 1:1 effector:target ratio to the spinoculated CD4 + T cells. The cells co-cultured in nonstimulating media (RPMI 1640 + Glutamax, 10% FBS) were incubated for three days prior to FACS analysis.

Walker-Sperling V.E., Pohlmeyer C.W., Tarwater P.M, & Blankson J.N. (2016). The Effect of Latency Reversal Agents on Primary CD8 + T Cells: Implications for Shock and Kill Strategies for Human Immunodeficiency Virus Eradication. EBioMedicine, 8, 217-229.

+ Open protocol

+ Expand

Induction of IFNβ1 and ISG15 in HIV-1 Latency

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HIV-1 latently infected T7 or the uninfected THP1 monocytic cell lines were transfected with 10 ng/ml poly(I:C) (Sigma-Aldrich) in 12 well plates using lipofectamine3000 (Thermo), according to the manufacturer’s instructions (Ranganath et al., 2016 (link)). Bryostatin-1 (Sigma-Aldrich) at a final concentration of 25 ng/ml was included in the medium of T7 cells immediately after poly(I:C) transfection, followed by the addition of 10 μM of the protease inhibitor indinavir (Sigma-Aldrich) in respective wells. The cells were incubated in 5% CO₂ at 37°C. After 48 h of incubation, mRNA was extracted from cells using RNeasy mini kit (QIAGEN). The amount and purity of the mRNA was assessed using NanoDrop One (Thermo Scientific) and stored at −80±C until further use. Reverse transcription was performed using ReverTra Ace qPCR-RT kit (TOYOBO). PCR reagents were purchased from Takara and the primers for IFNβ1 and ISG15 were obtained from Eurofins with the following sequences; IFNβ1 Fwd: GTCAGAGTGGAAATCCTAAG and IFNβ1 Rev: ACAGCATCTGCTGGTTGAAG (Hu et al., 2010 (link)) and ISG15 Fwd: CTCTGAGCATCCTGGTGAGGAA and ISG15 Rev: AAGGTCAGCCAGAACAGGTCGT (Matsunaga et al., 2020 (link)). The expression of genes was quantified using CFX96^TM Real-time system (Bio-Rad) and normalized against the expression of β-actin in the corresponding cells.

Jeremiah S.S., Miyakawa K., Matsunaga S., Nishi M., Kudoh A., Takaoka A., Sawasaki T, & Ryo A. (2021). Cleavage of TANK-Binding Kinase 1 by HIV-1 Protease Triggers Viral Innate Immune Evasion. Frontiers in Microbiology, 12, 643407.

+ Open protocol

+ Expand

Culturing Normal Human Astrocytes and U-87 Astrocytoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Normal human astrocytes (NHA) isolated from the cerebrums of 5-month-old human fetuses were purchased from Cambrex (CC-2565, Walkersville, MD, USA), and cultured according to the manufacturer’s protocol. The astrocytoma human cell line U-87 was routinely grown in cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Rockville, MD, USA) containing 10% heat-inactivated fetal calf serum, 1% penicillin/streptomycin, and 2 mM L-glutamine (ICN Pharmaceuticals, CA, USA) at 37 °C in a humidified atmosphere of 5% CO₂.
Bryostatin-1, prostratin, GF109203X, and rottlerin were purchased from Sigma (St. Louis, MO, USA). Pyrrolidine dithiocarbamate (PDTC), and BAY11-7082 were obtained from Santa Cruz Biotechnology (Santa Cruz CA, USA).

Díaz L., Martínez-Bonet M., Sánchez J., Fernández-Pineda A., Jiménez J.L., Muñoz E., Moreno S., Álvarez S, & Muñoz-Fernández M.Á. (2015). Bryostatin activates HIV-1 latent expression in human astrocytes through a PKC and NF-ĸB-dependent mechanism. Scientific Reports, 5, 12442.

+ Open protocol

+ Expand

Immune Modulator Compound Acquisition

Check if the same lab product or an alternative is used in the 5 most similar protocols

TNFα (300-01A) was purchased from Immunosource. Prostratin (12 deoxyphorbol-13-acetate) (PE 187–0001) were provided by Enzo Life Sciences. Bryostatin-1 (B7431) was purchased from Sigma. Ing-B was kindly donated by Luiz F. Pianowski, Kyolab/Amazônia Fitomedicamentos, Valinhos, Sao Paulo, Brazil. JQ1 (2091–1) and I-BET151 (2220–1) were purchased from BioVision. I-BET (401010) was purchased from Calbiochem. HMBA (H4663) was purchased from Sigma. Human CD3 (IMI1304) and CD28 (IMI1376) antibodies were obtained from Analis. BAY 11–7082 (B5556), Flavopiridol (F3055) and cyclosporin A (C2163000) were purchased from Sigma. Efavirenz (4624), Zidovidine (3485) and Raltegravir (11680) were obtained from the AIDS Research and Reference Reagent Program (National Institute of Allergy and Infectious Diseases [NIAID], National Institute of Health [NIH]).
All compounds, resuspended and stored as recommended by the manufacturer, were diluted immediately before use in cell culture medium.

Darcis G., Kula A., Bouchat S., Fujinaga K., Corazza F., Ait-Ammar A., Delacourt N., Melard A., Kabeya K., Vanhulle C., Van Driessche B., Gatot J.S., Cherrier T., Pianowski L.F., Gama L., Schwartz C., Vila J., Burny A., Clumeck N., Moutschen M., De Wit S., Peterlin B.M., Rouzioux C., Rohr O, & Van Lint C. (2015). An In-Depth Comparison of Latency-Reversing Agent Combinations in Various In Vitro and Ex Vivo HIV-1 Latency Models Identified Bryostatin-1+JQ1 and Ingenol-B+JQ1 to Potently Reactivate Viral Gene Expression. PLoS Pathogens, 11(7), e1005063.

+ Open protocol

+ Expand

Cell culture media and inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols

RPMI-1640 media containing glutamine were supplemented with 10% heat-inactivated FBS (Atlanta Biologics, Atlanta, GA, USA), 1 × 100 mM sodium pyruvate and 100 × Antibiotic and Antimycotic Solution purchased from Gibco (Thermo Fisher Scientific, Waltham, MA, USA). G418 sulphate solution was purchased from MP Biomedicals (Fisher Scientific, Waltham, MA, USA). Cycloheximide, Bryostatin-1 and MG132 were purchased from Sigma (Sigma-Aldrich, St. Louis, MO, USA). For PKD1 and MTA1 inhibition studies, selective PKD1 siRNA and MTA1 siRNA were purchased from Life Technologies (Thermo Fischer Scientific, Carlsbad, CA, USA).

Ganju A., Chauhan S.C., Hafeez B.B., Doxtater K., Tripathi M.K., Zafar N., Yallapu M.M., Kumar R, & Jaggi M. (2018). Protein kinase D1 regulates subcellular localisation and metastatic function of metastasis-associated protein 1. British Journal of Cancer, 118(4), 587-599.

+ Open protocol

+ Expand

Phorbol Ester and Protein Kinase C Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The
phorbol 12-myristate 13-acetate (PMA) was purchased from Sigma-Aldrich
(St. Louis, MO) or from LC Laboratories (Woburn, MA). Bryostatin 1
was purchased from Sigma-Aldrich or provided by the Developmental
Therapeutics Program of the National Cancer Institute. PDBu was from
LC Laboratories. [³H]PDBu (17.2 Ci/mmol) was from PerkinElmer
Life Sciences and was a custom radiosynthesis. Immortalized mouse
hippocampal cell line HT22 was obtained from ATCC (Manassas, VA).
Fetal bovine serum (FBS) was purchased from ZenBio (Research Triangle
Park, NC) or from ATCC (in the case of the live cell confocal experiments). Rattus norvegicus Munc13 green fluorescent protein constructs
were a generous gift from N. Brose (Max Planck Institute for Experimental
Medicine, Gottingen, Germany). Munc13-1 antibodies were purchased
from Synaptic Systems (Goettingen, Germany). All other reagents were
obtained from Thermo Fisher Scientific (Grand Island, NY).

Blanco F.A., Czikora A., Kedei N., You Y., Mitchell G.A., Pany S., Ghosh A., Blumberg P.M, & Das J. (2019). Munc13 Is a Molecular Target of Bryostatin 1. Biochemistry, 58(27), 3016-3030.

+ Open protocol

+ Expand

Modulating HIV-1 Latency with Bryostatin and X-ray

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HIV-1 latently infected, treated or not with ART cocktail, and control uninfected cells were plated onto 24-well or 12-well plates in 1 or 1.5 ml of complete culture medium respectively. After overnight incubation the cells were treated or not with various concentrations of bryostatin 1 (Sigma-Aldrich, St. Louis, MO) diluted in 1 × PBS and then exposed to various doses of X-ray irradiation using RS 2000 X-ray Irradiator (Rad Source, Suwanee, GA). The cell cultures were then incubated for 24, 48 or 72 h for virus activation.

Iordanskiy S., Van Duyne R., Sampey G.C., Woodson C.M., Fry K., Saifuddin M., Guo J., Wu Y., Romerio F, & Kashanchi F. (2015). Therapeutic doses of irradiation activate viral transcription and induce apoptosis in HIV-1 infected cells. Virology, 485, 1-15.

+ Open protocol

+ Expand

Generating Activated T Cells from Tumor-Draining Lymph Nodes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pmel-1 mice were inoculated in the hind footpads with 1×10⁶ B16-GMCSF cells. Ten days after footpad vaccination, popliteal tumor draining lymph nodes (DLN) were harvested under sterile conditions. DLNs were harvested and dispersed into single cell suspensions in complete RPMI media at 1×10⁶ cells/ ml. The cells were then activated by incubation with 5 nM Bryostatin 1 (provided by Sigma Aldrich, St. Louis, MO) and 1 µM Ionomycin (Calbiochem, San Diego, CA) (B/I), and 80 U/ml of rIL-2 (Peprotech, Rocky Hill, NJ) at 37°C for 18 h. Cells were then washed three times with warm complete RPMI and resuspended at 1–2×10⁶ cells/ml with either 40 U/ml of rIL- 2 or IL-7 + IL-15, each at 10 ng/ml. The cells were allowed to proliferate in culture for an additional 6 days and were split every 2–3 days in order to maintain 1x10⁶ cells/ml concentration. Additional cytokine at the above doses were also added when cells were split. Our previous work with this activation strategy has demonstrated that almost all remaining cells in culture after exposure to B/I and subsequently to cytokines are T cells.

Zoon C.K., Seitelman E., Keller S., Graham L., Blevins T.L., Dumur C.I, & Bear H.D. (2014). Expansion of melanoma-specific lymphocytes in alternate gamma chain cytokines: gene expression variances between T cells and T cell subsets exposed to IL-2 versus IL-7/15. Cancer gene therapy, 21(10), 441-447.

+ Open protocol

+ Expand

Small Molecule Therapeutic Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols

BIX-01294 (2-(hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-6,7-dimethoxy-N-[1-(phenylmethyl)-4-piperidinyl]-4-quinazolinamine trihydrochloride hydrate), SAHA (suberoylanilide hydroxamic acid), HMBA (N,N′-hexamethylene bis(acetamide)), disulfiram (tetraethylthiuram disulfide), bryostatin-1, and JQ1 were all purchased from Sigma-Aldrich. The positive controls Pam3Csk4 and poly(I:C) were purchased from InvivoGen.

Proust A., Barat C., Leboeuf M., Drouin J, & Tremblay M.J. (2017). Contrasting effect of the latency-reversing agents bryostatin-1 and JQ1 on astrocyte-mediated neuroinflammation and brain neutrophil invasion. Journal of Neuroinflammation, 14, 242.

+ Open protocol

+ Expand

CD8+ T-cell Activation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Latency model cells were obtained at day 17 of the experimental timeline shown in Fig 2A (immediately after depletion of productively-infected cells). These were pulsed for 2 hours with 10 nM bryostatin-1 (Sigma) in R-10, or maintained as unstimulated controls under matched conditions. Stimulated and unstimulated cells were then washed 4x with 14 ml R-10 (to remove bryostatin) and placed in R-10 for an additional 8 hours. HIV-specific CD8⁺ T-cells clones autologous to these targets were generated as described above. These were washed 3x with 14 ml R-10 and then co-cultured with target cells at a ratio of ~1:1 in R10 + 50 U/ml IL-2 + 1 μg/ml Brefeldin A + 1 μg/ml Monensin + 1/100 dilution of anti-CD107a-PE. Note that Brefeldin A is potent inhibitor of MHC-I antigen processing [37 (link)], thus antigen presentation profiles of target cells were arrested at this time point. Co-cultures were incubated at 37°C, 5% CO₂ for 8 hours. Cells were then surface stained with amine-aqua viability dye (Life Technologies), anti-CD4 Pacific Blue (Biolegend), anti-CD8 AlexaFluor 700 (Biolegend), and anti-CD3 BV785 (Biolegend). Cells were then fixed in 2% paraformaldehyde and analyzed on a Fortessa flow cytometer (BD). Recognition of target cells by CD8+ T-cells was assessed by measuring CD107a (degranulation) within the viable (amine-aqua^-) CD3⁺CD8⁺ population.

Thomas A.S., Jones K.L., Gandhi R.T., McMahon D.K., Cyktor J.C., Chan D., Huang S.H., Truong R., Bosque A., Macedo A.B., Kovacs C., Benko E., Eron J.J., Bosch R.J., Lalama C.M., Simmens S., Walker B.D., Mellors J.W, & Jones R.B. (2017). T-cell responses targeting HIV Nef uniquely correlate with infected cell frequencies after long-term antiretroviral therapy. PLoS Pathogens, 13(9), e1006629.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!