Abi prism 7900ht real time system

The total RNA from the brain tissue or cells was extracted and reversed transcribed using TRIzol Reagent (Invitrogen) and a Prime Script reagent RT Kit (Takara Biotechnology) according to the manufacturer's protocol. Real‐time qPCR was performed using an ABI Prism 7900HT Real‐Time System (Applied Biosystems Inc). The following primers were used: IL‐1β, AAATCTCGCAGCAGCACAT (forward) and CACACACCAGCAGGTTATCA (reverse); Cxcl‐1, CTGGGATTCACCTCAAGAACATC (forward) and CAGGGTCAAGGCAAGCCTC (reverse); Cxcl‐2, CCAACCACCAGGCTACAGG (forward) and GCGTCACACTCAAGCTCTG (reverse); TIM‐4, ACACATTTTCCCTGCCTCGT (forward) and GCTGTGGCAAGGATTTCACC(reverse); IL‐6, CCACTTCACAAGTCGGAGGCTTA (forward) and CCAGTTTGGTAGCATCCATCATTTC (reverse); TNF, TATGGCCCAGACCCTCACA (forward) and GGAGTAGACAAGGTACAACCCATC (reverse); and Actin, GACATGGAGAAGATCTGGCACCACA (forward) and ATCTCCTGCTCGAAGTCTAGAGCAA (reverse).
Actin was used as a housekeeping gene. The results were presented as the ratio of the gene to the expression of actin mRNA (sense and antisense).

Total RNA was isolated from HPDLCs with help of TRIzol reagent from Invitrogen followed by reverse transcription into cDNA using a High Capacity cDNA Reverse Transcription Kit from Applied Biosystems (Carlsbad, CA, U.S.A.). qPCR analysis was performed on an ABIPrism 7900HT Real-Time System (Applied Biosystems, Carlsbad, CA, U.S.A.) using the SYBR Green qPCR Master Mix from Applied Biosystems. The expression of TRIM52, TLR4, NF-κB p65, IL-6, IL-8, TNF-α and IL-10 were analyzed using the 2^−ΔΔC_t method with the β-actin as an internal reference. Primer sequences for these genes were listed as follows: TRIM52 forward: 5′-GCCATCTGCTTGGATTACTTC-3′, and reverse: 5′-TTCATCTTCCTCCTCGTTCTG-3′; TLR4 forward: 5′-CACAGACTTGCGGGTTCTACATC-3′, and reverse: 5′-AGTTCATAGGGTTCAGGGACAGG-3′; NF-κB p65 forward: 5′-AGGCAAGGAATAATGCTGTCCTG-3′, and reverse: 5′-ATCATTCTCTAGTGTCTGGTTGG-3′; IL-6 forward: 5′-AGGGCTCTTCGGGAAATGT-3′, and reverse: 5′-GAAGAAGGAATGCCCATTAACAAC-3′; IL-8 forward: 5′-ATGACTTCCAAGCTGGCCGTGGCT-3′, and reverse: 5′-TCTCAGCCCTCTTCAAAAACTTCTC-3′; TNF-α forward: 5′-CTCATCTACTCCCAGGTCCTCTTC-3′, and reverse: 5′-CGATGCGGCTGATGGTGTG-3′; IL-10 forward: 5′-GACTTTAAGGGTTACCTGGGTTG-3′, and reverse: 5′-TCACATGCGCCTTGATGTCTG-3′; β-actin forward: 5′-AGCGAGCATCCCCCAAAGTT-3′, and reverse: 5′-GGGCACGAAGGCTCATCATT-3′.