Hotstart taq

We did not succeed in combining the serotyping PCRs described by Jia et al. [13 (link)] as a multiplex PCR, neither by increasing the concentration of MgCl₂ nor by adding 3% DMSO (NEB, Frankfurt, Germany) or 5 × Q-solution (Qiagen, Hilden, Germany). Individual serovar monoplex-PCRs were carried out with Qiagen HotStart Taq as described above. Final concentrations for primers were: for serovar 2—0.5 µM, for serovar 8, 9, 13, 15—1 µM, and for the serovars 1, 4, 6, 7, 10, 11, 14—2 µM. Only the PCR identifying serovar 5 and 12, respectively, was run as a duplex PCR with a final concentration of 0.2 µM for each of the serovar 12 primers and 1.2 µM for each of the serovar 5/12 primers. Annealing temperatures were chosen as listed by Jia et al. for the different primers and held for 90 s. 35 cycles were run. All other reaction components and cycling parameters were the same as described above.

Templates used for pyrosequencing were prepared by bisulfite modified DNA. Each PCR was performed in a 40ul volume containing 0.6ul of each primer, 4ul 10XPCR buffer, 0.5ul QIAGEN hotstart Taq, 31.5ul distilled water, and 2.0ul template DNA (treated by bisulfite, EpiTect Bisulfite Kit, Qiagen). Reactions were incubated at 95°C for 3 min, followed by 50 amplification cycles (95°C for 15s, 54°C for 30s, 72°C for 30s), and then a final elongation step at 72°C for 5 min, with the temperature then held at 4°C. Amplicons were confirmed by agarose gel electrophoresis and purified using a QIAquick Gel Extraction Kit (Qiagen ). After mixed with 40ul sequencing buffer (contained 0.5uM sequencing primer), degeneration was performed at 80°C for 2 min. Pyrosequencing was performed using PyroMark ID sequencer.
Primer used in prosequencing.
Cg05163709 Forward: GGAAAGGGGTGATTAAATATTTAGTTA
Reverse: 5′-BIOTIN-CAACCTAATAAAAAACTATACAAACACAT
Sequencing primer: ATAAGTATGTTTAATTATTGTTTAAG
Cg27539833 Forward: GGAATAGTTTAGTTAAAGAAAAAGGTTAAGAT
Reverse: 5′-BIOTIN-AATTTACCACAATACACAAAAAACTAACTACTTA
Sequencing primer: AGATTTTAGTAGTTTTTTGTCGTTA

Cells were transfected with Fugene HD (Promega Corporation). After 48 h, ChIP was performed according to the X-ChIP protocol (Abcam) with minor modifications. Briefly, after cell harvesting, 250-μl cell lysates were sonicated as for primary neurons and checked by electrophoresis to give mainly small fragments of 300–500 bp. Lysates were immuno-precipitated with 2-μg mouse anti-HA antibodies (Sigma, H3663) overnight, followed by adding 20-μl DiaMag protein A-coated magnetic beads for 2 h. The complex was washed three times with IP buffer, once with low salt wash buffer and once with TE plus 50-mM NaCl. DNA was eluted and purified according to X-ChIP protocol. Input (3.5%) was used for comparison. DNA fragments were detected by PCR using Hotstart Taq (Qiagen) with specific primers. The sequences of ChIP Primers (5′ → 3′) were:
GBX2-F (TGCTAACTGCAGGATGGAGC) and GBX2-R (CTTGGAGACTCGAGGAAGCC); PRSS16-F (ATGAATCTGTTGGGCTGCGA) and PRSS16-R (TGGGTTTGCTTCCAGTACCC); BDNF-F (GCATTCAGTGGCTGCTTCAAGG) and BDNF-R (GGGCTGCAATGAACAGAGGTC); GRIN2A-F (GCTTAGAAGTGGCAGCCTCA) and GRIN2A-R(AATGCTTCTCCCTGTGCCTC); ACTB-F (GCGCCGCTGGGTTTTATAGG) and ACTB-R (CTCCTCTTCCTCAATCTCGCTC).

Variants that were significant by case–control analysis were validated by polymerase chain reaction (PCR) and Sanger sequencing. PCR primer sets were designed using Primer-BLAST [40 (link)]. DNA amplification by PCR was performed using HotStartTaq (Qiagen, Venlo, Netherlands) or Q5 High-Fidelity (New England Biolabs, Ipswich, MA, USA) DNA polymerase, as described in the manufacturer’s protocol. Primer sequences and their respective cycling conditions are listed in Additional file 4: Table S5. The PCR products were then analyzed by 2% agarose gel electrophoresis and purified with ExoSAP-IT Express (Thermo Scientific, USA) prior to sequencing. Cycle sequencing reactions were performed using BigDye Terminator v3.1 kit (Applied Biosystems, Foster City, CA) and the sequencing products were analyzed on a Genetic Analyzer. DNA sequences were visualized and aligned using Geneious Prime version 2022.1.

Microsatellite markers were chosen to span the entire genome [17 (link), 43 (link)]. Mosquitoes were collected from six countries (Obuasi, Ghana: N = 45, Pahou, Benin: N = 48, Lagdo, Cameroon: N = 48, Tororo, Uganda: N = 48) with two collection time points in Chikwawa, Malawi (2010: N = 48, 2002: N = 48) and Chokwe (2009: N = 48) and Morrumbene (2002: N = 45) Mozambique. 17 microsatellites (both di- and tri-nucleotide repeats) were amplified from genomic DNA using 1.5 μl of reaction Buffer, 0.2 μl of dNTP mix (25 mmol), 0.325 μl of both the forward (included a 19bp tag) and reverse primers, 0.2 μl of Hot Start Taq (Qiagen Inc.), 1 μl of MgCl₂ and 1μl of genomic DNA (15ng/ul). Forward and reverse primers are listed in S1 Table. PCR thermocycler conditions were: 5min at 95°C followed by 35 cycles of denaturing at 94°C for 30s, annealing at 58°C for 30s and extension at 72°C for 30s, finishing with an extension step at 72°C for 10min. Fragment sizing was carried out using a Beckman Coulter CEQ8000. Fragment sizes were visualized and recorded using the fragment analysis software on the Beckman Coulter CEQ8000. Micro-Checker version 2.2.3 [44 ] was used to check for null allele and scoring errors.