Ctrl mo

Manufactured by Gene Tools

Sourced in United States

Ctrl-MO is a laboratory equipment designed for genetic research and manipulation. It serves as a tool for controlling gene expression by utilizing morpholino oligonucleotides, which are synthetic molecules that can bind to and block the translation or splicing of target messenger RNA (mRNA).

Automatically generated - may contain errors

Lab products found in correlation

Ahr2 mo, by Gene Tools (2 mentions) Z 1 light sheet microscope, by Zeiss (1 mentions) Goat anti mouse igg cf594, by Merck Group (1 mentions) Im 300 microinjector, by Narishige (1 mentions) Femtojet, by Eppendorf (1 mentions)

6 protocols using ctrl mo

Knockdown of nipblb in Zebrafish Embryos

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Injections were carried out on one- to two-cell stage embryos. Two different morpholinos specific for nipblb: the nipblb-ATG_MO (5′-GTCCCCATTCATGCTGAAGAAGGGA-3′) and the nipblb-5′UTR-MO (5′-TCGCTGCTACTGATCCACCTTTAC-3′, Gene Tools, LLC, Philomath, OR, USA) were injected together at the concentration of 0.5 pmol/embryo each as described in [21 (link)]. In all experiments, MO-injected embryos were compared to embryos at the same developmental stage injected with the same amount of a ctrl-MO that has no target in zebrafish (Gene Tools).

Spreafico M., Mangano E., Mazzola M., Consolandi C., Bordoni R., Battaglia C., Bicciato S., Marozzi A, & Pistocchi A. (2020). The Genome-Wide Impact of Nipblb Loss-of-Function on Zebrafish Gene Expression. International Journal of Molecular Sciences, 21(24), 9719.

+ Open protocol

+ Expand

Electroporation-based Presenilin Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

To knock down PS-α expression, we electroporated a 3’ lissamine-tagged, translation-blocking antisense morpholino oligonucleotide (“PS-MO”) into the middle ventricle. This same morpholino has been used previously by another group to knock down presenilin in Xenopus tadpole embryos (Paganelli et al., 2001 (link)). The electroporation process was modified from Haas et al., 2002 (link). Briefly, tadpoles were anesthetized with 0.01% MS-222, and presenilin morpholino (PS-MO; GTCAGCGGAATCTTCAGACACTTGG; 0.1mM) or standard control morpholino (Ctrl-MO; CCTCTTACCTCAGTTACAATTTATA; 0.1mM) from Gene Tools (Philomath, OR) was injected into the middle ventricle of the optic tectum of stage 44/45 tadpoles by a glass micropipette. Next, two platinum electrodes are placed on the tadpole skin that flank the tectum and 3 × 60ms unipolar current pulses were delivered. The polarity of the current pulses was then reversed and the process repeated. After electroporation, tadpoles were transferred into a bowl that contains normal 10% Steinberg’s solution to recover. Neurons containing the lissamine-tagged morpholinos were identified through a RFP filter.

Liu Z., Thakar A., Santoro S.W, & Pratt K.G. (2018). Presenilin regulates retinotectal synapse formation through EphB2 receptor processing. Developmental neurobiology, 78(12), 1171-1190.

+ Open protocol

+ Expand

Knockdown of Zebrafish Cohesin Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Injections were carried out on one‐ to two‐cell stage embryos. Details of concentration and sequence of nipblb morpholino (nipblb‐MO, Gene Tools, Oregon, US) and rad21‐MO (Gene Tools) are described in Ref. ³⁴ and Ref. ²⁵, respectively. In all experiments, MO‐injected embryos were compared to embryos at the same developmental stage injected with the same amount of a ctrl‐MO that has no target in zebrafish (Gene Tools LLC). The runx1/PCS2+ construct was kindly provided by C.E. Burns¹⁸ and injected at a concentration of 200 pg/embryo.

Mazzola M., Pezzotta A., Fazio G., Rigamonti A., Bresciani E., Gaudenzi G., Pelleri M.C., Saitta C., Ferrari L., Parma M., Fumagalli M., Biondi A., Cazzaniga G., Marozzi A, & Pistocchi A. (2020). Dysregulation of NIPBL leads to impaired RUNX1 expression and haematopoietic defects. Journal of Cellular and Molecular Medicine, 24(11), 6272-6282.

+ Open protocol

+ Expand

Embryonic Neurodevelopment Visualization

Check if the same lab product or an alternative is used in the 5 most similar protocols

One-cell stage embryos microinjected with either 0.8pmol of either CTRLMO (GeneTools) or MCT8MO (27 (link)) were fixed at selected stages in ice-cold 4%PFA/PBS overnight at 4°C. Samples were washed, depigmented when needed with PBS/0.3%H2O2/0.5%KOH, transferred into 100% methanol, and stored at -20°C until use. Samples in 100% MeOH were brought to room temperature and washed using a MeOH : PBS series (100% MeOH to 100% PBS). Embryos were hydrated, washed in PBS with 0.1% Triton X-100 (PBTr), and blocked with the addition of 10% sheep serum (Sigma-Aldrich Aldrich). Primary antibodies used were: 1:500 rabbit anti-HuC/D (16A11 - Invitrogen), 1:100 CF594 mouse anti-Zrf1 (ZDB-ATB-081002-46, ZIRC) and 1:50 mouse anti-Nkx6.1 (F55A10 DSHB). Samples were washed, and secondary antibody fluorescent labelling was carried out using 1:400 of goat anti-mouse IgG-CF594 (SAB4600321, Sigma-Aldrich), goat anti-rabbit IgG- Alexa 488 (111-545-047, Jackson Labs) or anti-mouse IgG-CF488 (SAB4600388, Sigma-Aldrich). Imaging was carried out in a Zeiss Z.1 light-sheet microscope. Images were imported into Fiji, and a region of interest was selected in a two-somite area (8800µm²) between somites 8-12. For neuron number determination, the 3D object counter in Fiji was used. Glial cell abundance was measured by determining the stained area after maximum intensity projection.

Silva N, & Campinho M.A. (2023). In a zebrafish biomedical model of human Allan-Herndon-Dudley syndrome impaired MTH signaling leads to decreased neural cell diversity. Frontiers in Endocrinology, 14, 1157685.

+ Open protocol

+ Expand

Zebrafish Embryonic Manipulation with Morpholinos

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Zebrafish embryos were injected with morpholino antisense oligonucleotides blocking CYP1A or Ahr2 translation, or with a combination of both morpholinos, at the 1-4 cell stage as previously described [29 (link)]. Morpholinos targeting the transcriptional start site of CYP1A (CYP1A-MO; 5- TGGATACTTTCCAGTTCTCAGCTCT -3) [30 (link)] or Ahr2 (Ahr2-MO; 5- TGTACCGATACCCGCCGACATGGTT-3) [31 (link)] and control morpholinos (Ctrl-MO; 5- CCTCTTACCTCAGTTACAATTTATA-3) were obtained from Gene Tools (Philomath, OR, USA). The morpholinos were diluted in sterile-filtered deionized water to 0.15 mM (CYP1A-MO), 0.18 mM (Ahr2-MO) and 0.15/0.18 mM (Ctrl-MO) respectively. For injection of the combination of CYP1A-MO and Ahr2-MO morpholinos with twice the concentration was prepared. A Narishige IM-300 microinjector (Narishige, Tokyo, Japan) with a fine glass needle was used to inject 3-5 nL of morpholinos into the yolk of the embryos. All morpholinos were fluorescein-tagged and embryos were screened at 6-8 hpf by fluorescence microscopy to verify successful incorporation. Any damaged embryos or those not displaying homogenous fluorescence were removed. In addition to the MO-injected groups, groups of non-injected (NI) embryos were used.

Wincent E., Kubota A., Timme-Laragy A., Jönsson M.E., Hahn M.E, & Stegeman J.J. (2016). Biological effects of 6-formylindolo[3,2-b]carbazole (FICZ) in vivo are enhanced by loss of CYP1A function in an Ahr2-dependent manner. Biochemical pharmacology, 110-111, 117-129.

+ Open protocol

+ Expand

Ahr2 Knockdown in Zebrafish Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

Knockdown of Ahr2 was performed using an antisense oligonucleotide morpholino (MO) blocking ahr2 translation. Morpholinos targeting the transcriptional start site of ahr2 (Ahr2-MO; 5-TGTACCGATACCCGCCGACATGGTT-3) (Prasch et al., 2003 (link)) and negative control morpholinos (Ctrl-MO; 5-CCTCTTACCTCAGTTACAATTTATA-3) were obtained from Gene Tools (Philomath, OR, USA). The morpholinos were fluorescein-tagged to allow selection of properly injected embryos. Both morpholinos were diluted in deionized water to a final concentration of 0.15 mM. An Eppendorf FemtoJet with a fine glass needle was used to inject morpholinos into the yolk of 2- to 4-cell stage embryos. Embryos were screened at 6–8 hpf by fluorescence microscopy to verify incorporation of morpholinos. Damaged embryos and those without homogenous fluorescence were removed. Exposure was performed as described below and the experiments were repeated at least twice.

Wincent E., Stegeman J.J, & Jönsson M.E. (2015). Combination effects of AHR agonists and Wnt/β-catenin modulators in zebrafish embryos: implications for physiological and toxicological AHR functions. Toxicology and applied pharmacology, 284(2), 163-179.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!