The largest database of trusted experimental protocols

Mouse monoclonal anti gfp

Manufactured by Merck Group
Sourced in United States

The Mouse monoclonal anti-GFP is a laboratory reagent that binds to green fluorescent protein (GFP), a commonly used reporter protein. It can be used to detect and quantify the presence of GFP in biological samples.

Automatically generated - may contain errors

16 protocols using mouse monoclonal anti gfp

1

Immunohistochemistry of Synaptic Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunohistochemistry was performed as previously described20 (link). Antibodies used were: mouse monoclonal anti-GFP 1:250 (Millipore), rabbit anti-synapsin 1:1000 (Synaptic Systems)22 (link), rabbit anti-PSD95 (Abcam)23 (link), Cy-3 anti-rabbit 1:400, Alexa 488 donkey anti-mouse 1:400 (Invitrogen), and rabbit anti-goat Alexa 555 (Invitrogen). Double immunohistochemistry for GFP with anti-synapsin or anti-PSD95 was performed at 3 dpf as follows: embryos were fixed in 4% paraformaldehyde (PFA) in PBS for 1.5 hours at room temperature (RT) and washed briefly in PBS (3 × 5 min) with 0.1% Triton X-100 (PBST). Embryos were then blocked (PBS with 1% BSA, 1% DMSO, 2% goat serum, and 0.1% Triton X-100) for 3 hours at RT, and then incubated in blocking buffer with primary antibodies overnight at 4 °C. Embryos were washed with PBST, and incubated with secondary antibodies overnight at 4 °C.
For sectioning, stained larvae was cryoprotected in 30% of sucrose with PBS for at least 2 hr, rinsed briefly in Tissue-Tek O.C.T. compound (Sakura Finetek, Torrance, CA), and frozen in a Tissue-Tek O.C. ethanol/dry ice bath. Sections were 20 μm and mounted on the Superfrost Plus Microscope slides.
+ Open protocol
+ Expand
2

Comprehensive Immunohistochemistry Labeling Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunohistochemistry was performed as previously described (Bonkowsky et al., 2008 (link)). Antibodies used were: mouse anti-acetylated tubulin 1:250 (Sigma), mouse monoclonal anti-GFP 1:250 (Millipore), chicken anti-GFP 1:1000 (Aves Labs), mouse anti-HuC/D 1:400 (ThermoFisher), rabbit anti-dsRed 1:250 (Clontech), Cy-3 anti-rabbit 1:400 (Millipore), Alexa 488 donkey anti-mouse 1:400, Alexa 633 donkey anti-rabbit, Alexa 488 donkey anti-chicken 1:400, Alexa 555 rabbit anti-goat 1:400 (ThermoFisher), and 4',6-diamidino-2-phenylindole (DAPI).
+ Open protocol
+ Expand
3

Immunostaining of Adult Retina and Imaginal Eye Discs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Adult retina and imaginal eye discs from third instar larvae were dissected and fixed in 4% paraformaldehyde for 1 h on ice. Adult retina was washed in 0.5% PTX for 3 h to reduce autofluorescence. The tissues were blocked in 0.8% PBS + Triton-X + BSA for 2 h and incubated with primary antibody overnight at 4°C. The tissues were incubated in secondary antibody for 2 h at room temperature, washed in 0.1% PBS + Triton-X and mounted on glass slides with Vectashield (Vector Laboratories, Burlingame, CA, United States). Tissues were stained with the following antibodies: mouse monoclonal anti-TDP-43 antibody (1:500, Abcam, Cambridge, MA, United States), rabbit polyclonal anti-TDP-43 antibody (1:500, Proteintech, Chicago, IL,United States), rat monoclonal anti-Elav (1:20, DSHB, University of Iowa, Iowa City, IA, United States), mouse monoclonal anti-GFP (1:400, Millipore, Billerica, MA, United States), Alexa Fluor 633-conjugated Phalloidin (1:30, Invitrogen, Grand Island, NY, United States), Alexa Fluor 488 conjugated chicken anti-rat (1:400, Invitrogen, Grand Island, NY, United States) Alexa Fluor 568 conjugated goat anti-rabbit (1:400, Invitrogen, Grand Island, NY, United States) and Alexa Fluor 568 conjugated goat anti-mouse (1:400, Invitrogen, Grand Island, NY, United States).
+ Open protocol
+ Expand
4

Immunofluorescence Staining of SUMO1 and SUMO2/3

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunofluorescence staining was performed on paraffin-embedded brain sections (for SUMO1) or frozen brain sections (for SUMO2/3), as described previously (Yang et al., 2014 (link)). In short, after deparaffinization, brain sections (5-μm-thick) were incubated with primary antibodies at 4 °C overnight, followed by appropriate secondary fluorescent antibodies for 1 h at room temperature. The frozen brain sections (25 μm) were immunostained using a free-floating staining method. Confocal images were captured on a Leica SP5 confocal microscope (Leica Microsystems). The following primary antibodies were used: mouse monoclonal anti-SUMO1 (21C7; DSHB Hybridoma), rabbit polyclonal anti-SUMO2/3 (Covance), mouse monoclonal anti-GFP (Millipore), and rabbit polyclonal anti-GFP (Invitrogen).
+ Open protocol
+ Expand
5

Multicolor Immunohistochemistry Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunohistochemistry was performed as previously described (Bonkowsky et al., 2008) .
Antibodies used were: mouse anti-acetylated tubulin 1:250 (Sigma), mouse monoclonal anti-GFP 1:250 (Millipore), chicken anti-GFP 1:1000 (Aves Labs), mouse anti-HuC/D 1:400 (ThermoFisher), rabbit anti-dsRed 1:250 (Clontech), Cy-3 anti-rabbit 1:400 (Millipore), Alexa 488 donkey anti-mouse 1:400, Alexa 633 donkey anti-rabbit, Alexa 488 donkey anti-chicken 1:400, Alexa 555 rabbit anti-goat 1:400 (ThermoFisher), and 4',6-diamidino-2-phenylindole (DAPI).
+ Open protocol
+ Expand
6

Immunoblotting of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
For immunoblotting, samples were resolved by 10% SDS-PAGE and transferred to 0.45 μm Nitrocellulose membrane (Bio-Rad). Blots were blocked and probed with mouse monoclonal anti-GFP (Sigma-Aldrich: G1544; 1:1000 dilution), mouse monoclonal anti-β-actin (Cell Signaling: 8H10D10; 1:1000 dilution), rabbit anti-PISD (Santa Cruz Biotechnology: sc-86197; 1:1000 dilution), and rabbit anti-Tom20 (Santa Cruz Biotechnology: sc-17764; 1:400 dilution). Protein was visualized with either ECL Horseradish Peroxidase linked anti-rabbit or anti-mouse (Santa Cruz Biotechnology) secondary antibodies (diluted 1:10,000) and SuperSignal® West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, Rockford, IL, USA). The GFP antiserum was validated by immunoblotting of cell lysates expressing (or not) GFP. All other antisera were validated by immunoblot to confirm detection of antigen of the expected size.
+ Open protocol
+ Expand
7

GFP Immunoprecipitation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell lysates were pre-cleared. They were then incubated with protein G sepharose beads pre-treated with 4 µg of either mouse monoclonal anti-GFP (Sigma-Aldrich, St. Louis, MO, USA) or IgG control overnight at 4 °C. The beads were pelleted and washed in cold lysis buffer. RNA was extracted from the immunocomplexes or from the sciatic nerves with Trizol (Thermo Fisher Scientific, Waltham, MA, USA) and reverse transcribed with SuperScript® III First-Strand Synthesis System (Thermo Fisher Scientific, Waltham, MA, USA). Real-time PCR was carried out with SYBR Green I reagent (Roche USA, Indianapolis, IN, USA) on the LightCycler® 480. The following primers were used for amplification: mouse β-actin (sense, GTGACGTTGACATCCGTAAA; antisense, CAGTAATCTCCTTCTGCATC) and mouse 18S (sense, GCAATTATTCCCCATGAACG; antisense, GGCCTCACTAAACCATCCAA).
+ Open protocol
+ Expand
8

Protein Extraction and Immunoblotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Protein extraction was carried out by homogenizing leaf material in 2 v/w extraction buffer [8 m urea in 1 mm carbonate‐bicarbonate buffer, pH 10.6]. For immunoblotting, the primary and secondary antibodies used were mouse monoclonal anti‐GFP (Sigma‐Aldrich, St Louis, MO, US) and goat anti‐Mouse IgG whole molecules conjugated to alkaline phosphatase (AP; Sigma‐Aldrich), respectively, at a dilution of 1 : 5000.
+ Open protocol
+ Expand
9

GRASP Screen of Heberlein's Enhancer Trap

Check if the same lab product or an alternative is used in the 5 most similar protocols
A GRASP screen was carried out with a subset of the Heberlein's enhancer trap collection [45 (link)] and the analysis was performed at three timepoints (ZT2, 14 and 22). The mouse monoclonal anti-GFP from Sigma recognized the reconstituted GFP molecule but not the GFP1-10 or GFP11 fragments alone and was employed for GRASP analysis. A minimum of 15 brains were analyzed per genotype and timepoint. A positive GFP signal at a given timepoint was considered only if more than half of the brains presented reconstituted GFP signal. Only in those GAL4 lines that supported GFP reconstitution at some of the timepoints studied we confirmed that parental strains (pdf-lexA>lexAop-CD4GFP11 and X-GAL4>UAS-CD4GFP1-10) do not present GFP+ signal.
+ Open protocol
+ Expand
10

Antibody Profiling of LRRK2 Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary antibodies used include: mouse monoclonal anti-GFP (clones 7.1 and 13.1, Sigma), mouse monoclonal anti-LRRK2 (clone N241A/34, NeuroMabs), rabbit monoclonal anti-LRRK2 (clone MJFF2/c41-2, Abcam), mouse monoclonal anti-FLAG and anti-FLAG-HRP (clone M2, Sigma), rabbit monoclonal anti-pSer910-LRRK2 [clone UDD1 15 (3 (link)), Abcam], rabbit monoclonal anti-pSer935-LRRK2 [clone UDD2 10 (12 (link)), Abcam], rabbit monoclonal anti-pSer1292-LRRK2 (clone MJFR-19-7-8, Abcam), mouse monoclonal anti-β-tubulin (TUB 2.1, Sigma), rabbit polyclonal anti-dynamin-1 (PA1-660, Thermo Fisher Scientific), rabbit polyclonal anti-tyrosine hydroxylase (NB300-109, Novus Biologicals), rabbit monoclonal anti-phospho-Thr73-RAB10 (MJF-R21 or MJF-R21-22–5, Abcam), anti-phospho-Thr72-RAB8A (MJF-R20, Abcam), rabbit monoclonal anti-RAB10 (D36C4, Cell Signaling Technology), mouse monoclonal anti-human adenovirus 5, hexon capsid protein (clone 9C12, Developmental Studies Hybridoma Bank), mouse monoclonal anti-GAPDH (clone 1E6D9, Protein Tech). For bright-field microscopy, biotinylated goat anti-mouse and anti-rabbit secondary antibodies (Vector Laboratories) were employed. For Western blots, light chain-specific mouse anti-rabbit IgG-HRP and goat anti-mouse IgG-HRP (Jackson Immunoresearch) secondary antibodies were used.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!