The largest database of trusted experimental protocols

Easysep human cord blood cd34 positive selection kit

Manufactured by STEMCELL
Sourced in Canada, France

The EasySep Human Cord Blood CD34 Positive Selection Kit is a lab equipment product designed to isolate and enrich CD34-positive cells from human cord blood samples. The kit utilizes magnetic particles and a specialized buffer to selectively bind and separate the target CD34-positive cells from the rest of the sample, allowing for their isolation and further analysis or experimentation.

Automatically generated - may contain errors

6 protocols using easysep human cord blood cd34 positive selection kit

1

Humanized Mouse Model for Small Cell Lung Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transgenic mice strain NSG-HLA-A2 (JAX #014570) and NSG- SGM3 (Jax #013062) were crossed to generate NSG-HLA-A2-SGM3. NSG-HLA-A2-SGM3 mice were whole-body irradiated at 4 weeks at 100 cGy. Donor human umbilical cord blood was first balanced with equal volume of PBS and then 35 ml of balanced blood was added to 15 ml of Lymphoprep Density gradient medium (Stem Cell technologies, Cat#7861) to isolate mononuclear cells. Human CD34+ hematopoietic stem cells (HSCs) were isolated from processed mononuclear cells using EasySep Human Cord Blood CD34 Positive Selection Kit (Stemcell, Cat#17896). 1 × 105 human CD34+ HSCs were IV injected into irradiated NSG-HLA-A2-SGM3 mice 24 h after radiation. Mice were kept on Bactrim water for 4 weeks after the procedure to prevent infection. Human CD45+ reconstitution was confirmed at 12 weeks post HSC inoculation in peripheral blood by flow cytometry. Reconstituted mice were then subcutaneously inoculated with 5 × 106 H69 cells. Both male and female mice were included in all studies. Tumors were measured and volumes were quantified as detailed above. 5 × 106 H69 were also inoculated into un-reconstituted NSG-HLA-A2-SGM3 mice.
+ Open protocol
+ Expand
2

Isolation and Maintenance of Human CD34+ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T (GTX) cells were provided as a kind gift from Kenneth Cornetta (Indiana University School of Medicine, Indianapolis, IN, USA). Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS; Omega Scientific, Tarzana, CA, USA), 1% penicillin and streptomycin, and 1× L-glutamine. Human cord blood was provided by the Cleveland Cord Blood Center (Cleveland, OH, USA), under approved institutional protocols and in accordance with the Declaration of Helsinki. Primary human CD34+ cells were isolated using the EasySep Human Cord Blood CD34 Positive Selection Kit according to manufacturer’s instructions (STEMCELL Technologies, Vancouver, BC, Canada). Sorted cell purity was checked by flow cytometry, and only cells with >95% CD34+ were used in further experiments. Following purification and purity check, cells were frozen in FBS/10% DMSO by liquid nitrogen until later use. THP-1 and KG-1a cells were obtained from the American Type Culture Collection. Raji cells were a kind gift from David Rawlings (Seattle Children’s Research Institute, Seattle, WA, USA). Frozen G-CSF mPB CD34+ cells were purchased from the Co-Operative Center for Excellence in Hematology at the Fred Hutchinson Cancer Research Center (Seattle, WA) under approved institutional protocols.
+ Open protocol
+ Expand
3

Cord Blood CD34+ HSPC Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human CD34+ HSPCs were isolated from cord blood obtained from ITxM Clinical Services (Rosemont, IL) using the EasySep Human Cord Blood CD34-positive Selection kit (Stem Cell Technologies). The EGR1 shRNA 5’TTGTCTGCTTTCTTGTCTTT3’ or control Renilla (Ren) sequence 5’TAGATAAGCATTATAATTCCT3’ was cloned into the previously described pCDH-LMN-mGFP Expression Lentivector28 (link). Lentivirus was generated by transfection of 293T cells with pCDH-LMN-mGFP and packaging/envelope plasmids (psPAX2, pCMV-VSVG). CD34+ cells were grown in SFEM II serum-free media (Stem Cell Technologies) with the addition of 50ng/ml human IL3, IL6, SCF, and TPO, transduced with Ren or EGR1 shRNA, and GFP-sorted 4 days later to maintain cells in a pluripotent state.
+ Open protocol
+ Expand
4

Isolation of Human Cord Blood CD34+ HSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human umbilical cord blood was collected from KK Women’s and Children’s Hospital (KKH), Singapore, with written consent obtained from guardians of donors and in strict accordance with the institutional ethical guidelines of KKH. SingHealth and National Health Care Group Research Ethics Committees Singapore specifically approved this study (IRB no: 2013/778/D). The cord blood was purified by density centrifugation with Lymphoprep (Stemcell Technologies, Vancouver, BC, Canada) and red blood cells (RBC) were lysed by EasySep RBC lysis buffer (Stemcell Technologies). Thereafter, human CD34+ HSCs were enriched using EasySep Human Cord Blood CD34 Positive Selection kit (Stemcell Technologies) according to manufacturer’s instructions.
+ Open protocol
+ Expand
5

Culturing HEK293, HEK293T, and CD34+ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 and HEK293T were cultured in Dulbecco’s Modified Eagle’s Medium (Lonza, Basel, Switzerland). Culture medium was supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 250 μg/ml L-glutamine. Human cord blood was obtained from Aarhus University Hospital. CD34+ cells were purified from umbilical cord blood using EasySep Human Cord Blood CD34 Positive Selection Kit (STEMCELL Technologies, Grenoble, France) and cultured in StemSpan serum-free expansion medium (STEMCELL Technologies) supplemented with human early-acting cytokines (PeproTech, Rocky Hill, NJ) including stem cell factor (SCF) 100 ng/ml, Flt3 ligand (Flt3-L) 100 ng/ml, thrombopoietin (TPO) 50 ng/ml, and interleukin 3 (IL-3) 20 ng/ml and enhancer of self-renewal UM171 50 nM (STEMCELL Technologies). Induced pluripotent stem cells, described in a previous publication (Kang et al., 2015 (link)), were cultured using TeSR-E8 medium (STEMCELL Technologies) on Vitronectin XF (STEMCELL Technologies) coated culture dish. All cells were cultured at 37°C and 5% (vol/vol) CO2.
+ Open protocol
+ Expand
6

Isolation and Expansion of Cord Blood CD34+ HSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
UCB units were obtained from Beijing Cord Blood Bank with informed consent from healthy volunteer donors. After Histopaque-1077 (Sigma-Aldrich) gradient separation, mononuclear cells were collected and CD34+ haematopoietic stem cells (HSCs) were isolated using the EasySep Human Cord Blood CD34 Positive Selection Kit (Stemcell Technologies, #17896). After selection, CD34+ cells were cultured in StemSpan H3000 (Stemcell Technologies, #09800) added with expansion supplement (Stemcell Technologies, #02691).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!