Cells seeded in an 8-well chamber slide were fixed and blocked using 5% formaldehyde and 5% BSA, respectively. They were then stained with antibodies against stat5 (cat. no. sc-836; Santa Cruz, Dallas, TX, USA) and pak1 (cat. no.: ab40852; Abcam). Alexa Fluor 488- and 594-tagged secondary antibodies raised in species appropriate for the primary antibody were used followed by counterstaining with DAPI. All slides were examined using a confocal microscope (Nikon Eclipse Ti; Nikon).
Ab40852
Manufactured by Abcam
Sourced in United States
Ab40852 is a primary antibody that recognizes the 40 amino acid form of the amyloid beta (Aβ) protein. It is designed for use in various research applications, including Western blotting, immunohistochemistry, and ELISA.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using ab40852
1
Immunofluorescent Staining of Stat5 and Pak1
2
Investigating Actin Cytoskeleton Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals were purchased from Sigma-Aldrich (St. Louis, MO) or Fisher Scientific (Nepean, ON, Canada) unless otherwise indicated. The PAK1 inhibitor IPA-3 was purchased from EMD Chemicals (Gibbstown, NJ). GABA was purchased from Abcam (Toronto, ON). Antibodies to the following proteins were obtained from the indicated suppliers: Anti-TKS5 (SH3 #1) EMD Millipore 09-403, Myosin Light Chain 2 ABM Y021157, Myosin Light Chain 2 antibody [EPR3741] Abcam ab92721, p-MYL9 Antibody (Thr 18/Ser 19)-R Santa Cruz Biotechnology sc-12896-R, Phospho-PAK1 (Thr423)/PAK2 (Thr402) Antibody Cell Signaling Technology 2601S, Anti-PAK1 antibody Abcam ab40852, Cofilin (phospho S3) antibody Abcam ab12866, Anti-Cofilin antibody (ab42824) Abcam ab42824. All secondary antibodies and Alexa Fluor 647–labeled phalloidin were purchased from Invitrogen (Burlington, Canada). PAK1 shRNA construct (CCAAGAAAGAGCTGATTATT) and control plasmid pLKO.1 was kindly provided by Dr. Jason Moffat and the Ontario Institute for Cancer Research (OICR) Genomics Facility. The pEGFR-GFP plasmid was obtained from Addgene (Plasmid #32751). The MLC2 T18A,S18A plasmid was obtained from Addgene (Plasmid # 35681).
3
Western Blotting Antibody Conditions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Western blotting the primary antibodies used were (Abcam, Cambridge, MA, USA): polyclonal to DSCAM (ab85362), monoclonal to PAK1 (ab40852), PAK2 (ab76293), PAK3 (ab40808), polyclonal to phosphor-PAK1 S204 (ab79503), monoclonal to LIMK1 (ab117623), polyclonal to phosphor-LIMK1 T508 (ab38508), polyclonal to Cofilin (ab42824), phospho S3 Cofilin (ab12866), monoclonal to beta Tubulin (ab11308), and secondary antibodies HRP conjugated (ab6802 and ab6820). For DSCAM stimulation, 500 ng/mL Mouse Netrin 1 peptide (ab91607, Abcam) was used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!