Cell cycle and apoptosis were assessed by flow cytometry (FACS Canto II, BD). For cell cycle analysis, 48 h following transfection, Bel7402, HepG2, or Huh7 cells were seeded in triplicates in 12-well plates at 1 × 105 cells/well, synchronized by serum starvation, and allowed to grow for 18–24 h. Cells were collected, washed with phosphate-buffered saline (PBS), and fixed in cool ethanol at −20 °C overnight before being stained with propidium iodide (PI) (KeyGEN BioTECH, China) at room temperature for 30 min. For apoptosis analysis, cells were collected, washed with PBS, double-stained with Annexin V-FITC and PI using an Apoptosis Detection Kit (TransGen Biotech, China) at room temperature for 15 min in the dark
Apoptosis detection kit
Manufactured by Transgene
Sourced in China
The Apoptosis Detection Kit is a laboratory tool designed to detect and analyze apoptosis, a form of programmed cell death. The kit provides the necessary reagents and protocols to identify and quantify apoptotic cells using various techniques, such as flow cytometry or fluorescence microscopy. The core function of the kit is to facilitate the assessment of cellular apoptosis in research and experimental settings.
Automatically generated - may contain errors
Lab products found in correlation
Facscanto 2, by BD (1 mentions)
Propidium iodide, by Keygen Biotech (1 mentions)
Fg 4592, by Cayman Chemical (1 mentions)
Pcr kit rr036a and rr420a, by Takara Bio (1 mentions)
Tlr4 antibody, by Proteintech (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
In situ cell death detection kit, by Roche (1 mentions)
2 protocols using apoptosis detection kit
1
Cell Cycle and Apoptosis Analysis by Flow Cytometry
2
Detailed Protocol for qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FG-4592 was purchased from Cayman Chemical Company (www.caymanchem.com ), and normal saline (NS) was obtained from Changhai Hospital (Shanghai, China). The apoptosis detection kit was purchased from TransGen (Beijing, China). The PCR kit (RR036A and RR420A) was purchased from TAKARA (Japan). RPMI 1640, DMEM and fetal bovine serum (FBS) were supplied by Gibco (New York, USA). Organoid cultures were obtained from STEM CELL. BCL2, BAX, C-CASPASE3, GAPDH, NF-κB and P-IKK-β antibodies were supplied by CST. The TLR4 antibody was supplied by Proteintech. In Situ Cell Death Detection Kit was obtained from Roche (Basel, Switzerland). The primes were obtained from Shenggong Biotech (Shanghai, China). The list of primers is shown in Table 1 .
qRT-PCR primers for the eight genes evaluated
| Gene symbol | Forward | Reverse |
|---|---|---|
| TLR4 | AAATGCACTGAGCTTTAGTGGT | TGGCACTCATAATGATGGCAC |
| IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
| IGFBP2 | CAGACGCTACGCTGCTATCC | CCCTCAGAGTGGTCGTCATCA |
| SOX2 | GCGGAGTGGAAACTTTTGTCC | CGGGAAGCGTGTACTTATCCTT |
| REG2 | CTGATGTTCCTGTCATACAGCC | CCAGGTCAAACGGTCTTCAATTA |
| REG3B | ACTCCCTGAAGAATATACCCTCC | CGCTATTGAGCACAGATACGAG |
| REG3D | GACTCCATGATCTGTCACTTGG | CATAGGGAAATGTTGGGTCACAA |
| HK1 | CAAGAAATTACCCGTGGGATTCA | CAATGTTAGCGTCATAGTCCCC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!