Anti 3 tubulin antibody

Manufactured by Promega

The Anti-ßIII-tubulin antibody is a laboratory reagent used to detect and quantify the presence of the ßIII-tubulin protein. ßIII-tubulin is a structural component of microtubules and is commonly used as a marker for neuronal cells. The antibody can be used in various immunodetection techniques, such as Western blotting, immunocytochemistry, and immunohistochemistry, to identify and study ßIII-tubulin-expressing cells and tissues.

Automatically generated - may contain errors

Lab products found in correlation

Rhodamine phalloidin, by Thermo Fisher Scientific (3 mentions) Kod hot start dna polymerase, by Toyobo (2 mentions) Anti myc, by Merck Group (2 mentions) Anti flag, by Merck Group (2 mentions) Anti β actin, by Merck Group (2 mentions) Paav u6 gfp expression vector, by Cell Biolabs (1 mentions) Pi plc, by Merck Group (1 mentions) Anti gm130 antibody, by BD (1 mentions) Cycloheximide (chx), by Fujifilm (1 mentions) Anti gfap, by Merck Group (1 mentions) J 113397, by Bio-Techne (1 mentions) Anti ha, by Merck Group (1 mentions)

2 protocols using anti 3 tubulin antibody

Generation and Characterization of Nogo-A Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

C-terminal–tagged WT human Nogo-A plasmid has been previously described (2 (link)) and used for generating N-terminal FLAG–tagged Nogo-A and mutant constructs by PCR-methods using KOD Hot start DNA polymerase (TOYOBO) and sequenced. HSPA8 expression plasmid (#OHu27538D) purchased from GenScript was subcloned to pAAV-CAG vector. pAAV-U6-GFP expression vector (#VPK-413, Cell Biolabs) was used for making shRNA constructs. Targeting shRNA sequences are shNC:TTCTCCGAACGTGTCACGT, shHSPA8#1: GCTCGATTTGAGGAGTTGAAT, and shHSPA8#2: CGTAGGTTTGATGATGCTGTT. Anti-Myc (#M4439 or #C3956), anti-FLAG (#F7425), and anti-beta-actin (#A1978) antibodies (Sigma), anti-ßIII-tubulin antibody (#G7121, Promega), anti-Nogo-A (#AF3098 or #AF3515, R&D), anti-HSPA8 (#D12F2, Cell Signaling Technology), and anti-GFP antibody (#sc-9996, Santa Cruz Biotechnology) were used for following experiments. Rabbit polyclonal antibody against Nogo-A aa186 to 213 was generated using purified GST-fused Nogo-A 186 to 213 as an antigen (Covance). Rhodamine phalloidin (#R415) was purchased from Thermo Fisher Scientific.

Sekine Y., Wang X., Kikkawa K., Honda S, & Strittmatter S.M. (2023). Amino-terminal proteolytic fragment of the axon growth inhibitor Nogo-A (Rtn4A) is upregulated by injury and promotes axon regeneration. The Journal of Biological Chemistry, 299(10), 105232.

+ Open protocol

+ Expand

Molecular Characterization of Nogo Receptor

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

WT human NgR1 (61 (link)) was subcloned into p3xFLAG-CMV9 vector and used for generating mutant constructs by PCR methods using KOD Hot start DNA polymerase (Toyobo) and sequenced. Hemagglutinin (HA)–neuropilin (62 (link)), Myc-NgR1 (25 (link)), and Myc-NgR2 (63 (link)) have been previously described. HA-tagged human ORL1 construct was obtained from UMR cDNA Resource Center. Anti-ORL1 rabbit serum was a gift from J. Hamid, University of Calgary (64 (link)). Anti-FLAG (#F7425 or #F3165), anti-HA (#H9658 or #H6908), anti-Myc (#M4439 or #C3956), anti-GFAP (#G3893), and anti–β-actin (#A1978) antibodies (all from Sigma-Aldrich), anti-NgR1 (#AF1440) and anti-NgR2 (#AF2776) antibodies (R&D Systems), anti-ORL1 antibody (#RA14140, Neuromics), anti–ßIII-tubulin antibody (#G7121, Promega), anti–5-hydroxytryptamine (5HT) antibody (#20080, ImmunoStar), and anti-GM130 antibody (#610823, BD Transduction Laboratories) were used for the following experiments. PI-PLC was from Sigma- Aldrich, CHX was from Wako, benzyl-GalNAc and nociceptin were from Calbiochem, and (±)-J113397 was purchased from Tocris Bioscience. Nogo22 protein has been described previously (27 (link)).

Sekine Y., Siegel C.S., Sekine-Konno T., Cafferty W.B, & Strittmatter S.M. (2018). The nociceptin receptor inhibits axonal regeneration and recovery from spinal cord injury. Science signaling, 11(524), eaao4180.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!