U2OS T-REx cells were transfected with pAIO-GFP-MSH3 or pAIO-GFP-MSH3-Y245S/K246E constructs using TransIT-X2 reagent (Mirus). Transfected cells were selected in the presence of puromycin (1 μg/ml; InvivoGen). Clones were isolated after 10 to 14 days of growth in the selection medium. The expression of the desired proteins upon doxycycline induction was tested by Western blotting with anti-GFP and anti-MSH3 antibodies. CRISPR-Cas9–generated FANCJ HeLa FlpIn T-REx (FANCJ−/− HeLa FIT) knockout cells (39 ) were cotransfected with pDONR221-based vector expressing either wild-type, K52R, or K141/142A variant of FANCJ, as well as an Flp-In-compatible expression vector plasmid (pOG44) encoding for Flp recombinase, using TransIT-X2 reagent (Mirus). Transfected FANCJ−/− HeLa FIT cells were selected in the presence of blasticidin (15 μg/ml; InvivoGen) and hygromycin (150 μg/ml; InvivoGen). The expression of these constructs allowing complementation of FANCJ-deficient cells with FANCJ variants upon doxycycline induction was tested by Western blotting with anti-FANCJ antibody.
Transit x2 reagent
Manufactured by Mirus Bio
Sourced in United States
The TransIT-X2 reagent is a proprietary transfection reagent developed by Mirus Bio. It is designed to facilitate the delivery of nucleic acids, such as plasmid DNA, mRNA, and siRNA, into a variety of cell types with high efficiency.
Automatically generated - may contain errors
Lab products found in correlation
Pgeneclip shmybbp1a, by Qiagen (2 mentions)
Sirna oligonucleotides, by Merck Group (2 mentions)
Miseq system, by Illumina (2 mentions)
Qiamp dna mini kit, by Qiagen (2 mentions)
Hygromycin, by InvivoGen (1 mentions)
Blasticidin, by InvivoGen (1 mentions)
Puromycin, by InvivoGen (1 mentions)
Silencer select sirna, by Thermo Fisher Scientific (1 mentions)
Transit siquest, by Mirus Bio (1 mentions)
Doxycycline, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 myc his b, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Butyrate, by Merck Group (1 mentions)
Caco 2, by American Type Culture Collection (1 mentions)
Roswell park memorial institute (rpmi), by Thermo Fisher Scientific (1 mentions)
Ps100001, by OriGene (1 mentions)
Epidermal growth factor (egf), by Promega (1 mentions)
Epidermal growth factor (egf), by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Hepatocyte medium, by ScienCell (1 mentions)
49 protocols using transit x2 reagent
1
FANCJ Variant Expression in FANCJ-Deficient Cells
2
Transfection and Selection of Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Subconfluent cells were transfected with TransIT-X2 reagent (Mirus) according to the manufacturer’s instructions. At 48 h, the cells were seeded in 10-cm plates with medium containing the appropriate selection drug (100–450 μg/ml G418, 0.25–0.4 μg/ml puromycin or 0.25–0.4 μg/ml blasticidin). Cells were transfected with the plasmids indicated in Supplementary Table 1 :
3
Transfection of siRNA and miRNA Mimics/Inhibitors
4
Stable Oral Cancer Cell Depletion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CPAP-depleted stable oral cancer cells were generated using the pLKO.1-TRC-puromycin lentiviral vector-based system (Sigma Mission shRNA system). Constitutive and Doxycycline inducible vectors expressing scrambled control-shRNA or CPAP-specific-shRNA (GCTAGATTTACTAATGCCA) showing validated 80% CPAP knockdown were either purchased from the Sigma Mission shRNA library or custom cloned by GenScript. EGFR specific (catalog# sc-29301), and scrambled control siRNAs were purchased from Santa Cruz Biotech. Doxycycline was purchased from Fisher Scientific. Transfections were performed using the TransIT-X2 reagent or TransIT-siquest (MirusBio).
5
Amplification and Insertion of XBP1s and Trap1 in HK-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The XBP1s and Trap1 were amplified by PCR from the cDNA prepared from HK-2 cells using the following primers. For XBP1s: 5′-ATCggCTAgCATggATTATAAggATgACgACgATAAAgTggTggTggCAgCCgCg-3′, 5′-CgATgCTAgCTTAgACACTAATCAgCTggggAAAgAgTTC-3′. The product was inserted into the Nhel sites of pLKO-AS3w-puro (Academia Sinica, Taipei, Taiwan). For Trap1: 5′-ATTAggTACCATggCgCgCgAgCTgCg-3′, 5′-ATgAgAATTCCAgTgTCgCTCCAgggCC-3′. The product was inserted into the KpnI and EcoR1 sites of pcDNA3.1(+)/myc-His B (Thermo Fisher Scientific). For the transfection conditions, 40 nM of siRNA and 1 μg of plasmid for a 35 mm dish was premixed with TransIT-X2 reagent (Mirus Bio) according to the manufacturer’s protocol.
6
Genetic Engineering: Transfection and Selection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Subconfluent cells were transfected with TransIT-X2 reagent (Mirus, Madison, WI, USA) according to the manufacturer’s instructions. At 48 h, cells were seeded in 10-cm plates with media containing a selection drug (0.5–1 µg/mL puromycin, 50 µg/mL hygromycin B and 400 µg/mL G418). Cells were transfected with the following plasmids: pGene Clip-hygromycin negative control (GGAATCTATTCGATGCATAC) (QUIAGEN, Hilden, Alemania), referred through the text as V; pGeneClip shMYBBP1A (TCCCTGTCACGCCTACTTTCT) (QIAGEN #3336312 KH08420H), referred through the text as sh; pRetrosuper-puro, referred through the text as V2; pRetrosuper shMYBBP1A (GCAGAAGGAGTTCAAGAGACTCCTTCTGCAGCTTGTTCTTTTTGGAA), referred trough the text as sh2; pcDNA3-neomicine; pcDNA3-2xFlag-human-c-MYB; pBabe-puro and HA-VHLwt-pBabe-puro. pcDNA3-2xFlag-human-c-MYB was kindly provided by Shengao Jin and HA-VHLwt-pBabe-puro was a gift from William Kaelin (Addgene plasmid # 19234; http://n2t.net/addgene:19234 ; RRID: Addgene_19234).
7
Transfection of HEK293 Cells with PLN and VHL
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We maintained HEK293 cells in Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cultured HEK293 cells were transfected with PLN cDNA for 24 h, followed by their transfection with VHL-targeting small interfering RNA (siRNA) or HA-tagged VHL cDNA using TransIT-X2 reagent (Mirus, Madison, WI, USA), according to the manufacturer’s instruction.
8
Caco-2 Cell Culture and Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human colon cancer cells (Caco-2) were purchased from ATCC (Tell City, USA) and maintained in RPMI (Thermo Fisher Scientific, Waltham, USA) supplemented with 10% foetal bovine serum (FBS) (Thermo Fisher Scientific).
Cells were transfected with the indicated plasmids using the TransiT-X2 reagent (Mirus, Madison, USA) according to the manufacturer’s instructions. After 48 h, butyrate (2 mM, Sigma-Aldrich, United Kingdom) was added at indicted time.
Cells were transfected with the indicated plasmids using the TransiT-X2 reagent (Mirus, Madison, USA) according to the manufacturer’s instructions. After 48 h, butyrate (2 mM, Sigma-Aldrich, United Kingdom) was added at indicted time.
9
Alveolus Chip Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human alveolus chips were transfected with plasmid DNA using the TransIT-X2 reagent (Mirus Bio). In all, 3 μg of plasmid DNA and 6 μl TransIT-X2 reagent were constituted in 300 μl OPT-MEM before added to 3 ml chip flow medium. Then 1.5 ml of the solution was added to apical and basal inlet reservoirs and flew at 60 μl/h for 24 h. Then apical channel was emptied to reestablish ALI; basal channel was changed to normal flow medium for additional 24 h before qPCR analysis.
10
Cellular Growth and Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all studies, cells were grown on glass coverslips in 6-well dishes to 75% confluence and treated with compound or DMSO (vehicle) for 17–20 hrs. For multi-day experiments, cells were given fresh media containing compound or DMSO each day. Cell monolayers were rinsed with PBS and fixed with phosphate buffered formalin for 10 min at room temperature (RT).
Cell transfections were accomplished using TransIT-X2 reagent (Mirus Bio) according to the manufacturer’s recommendations unless otherwise indicated.
Cell transfections were accomplished using TransIT-X2 reagent (Mirus Bio) according to the manufacturer’s recommendations unless otherwise indicated.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!