The third generation lentiviral transfer plasmid pXPR_dCas9-VPR_sgRNA was cloned from pXPR_dCas9-VP64-Blast (Addgene plasmid #61425) [19 (link)]. For mouse GPx2 sgRNA design, two custom anti-sense DNA oligonucleotides (CTTTGTTCAGTGGCAGTAAG, TTGTTCAAACAGTTCACAGG) were annealed and ligated into pXPR_dCas9-VPR_sgRNA. Non-targeting pXPR_dCas9-VPR with no GPx2-sgRNA inserted recognition sequence was used as a control. Lentiviral construct for dCas9-VPR-sgRNA and virus particles was prepared by Memorial Sloan Kettering Cancer Center, New York.
Plvx puro
The PLVX-puro is a lentiviral vector designed for gene expression and knockdown studies. It contains a puromycin resistance gene for selection of transduced cells.
Lab products found in correlation
102 protocols using plvx puro
Lentiviral Overexpression of Mouse and Human GPx2
The third generation lentiviral transfer plasmid pXPR_dCas9-VPR_sgRNA was cloned from pXPR_dCas9-VP64-Blast (Addgene plasmid #61425) [19 (link)]. For mouse GPx2 sgRNA design, two custom anti-sense DNA oligonucleotides (CTTTGTTCAGTGGCAGTAAG, TTGTTCAAACAGTTCACAGG) were annealed and ligated into pXPR_dCas9-VPR_sgRNA. Non-targeting pXPR_dCas9-VPR with no GPx2-sgRNA inserted recognition sequence was used as a control. Lentiviral construct for dCas9-VPR-sgRNA and virus particles was prepared by Memorial Sloan Kettering Cancer Center, New York.
Overexpression of TRIM48 in Glioma Cells
Plasmid Constructs for Cell Biology
Engineered RBCs Expressing Chimpanzee CMAH
Overexpression of Human NLRP3 in Cells
SUMO1 Overexpression and Silencing in HTEC Cells
SUMO1 Overexpression and Silencing in HTEC Cells
Cloning and Characterization of EIF1AX Variants
Investigating miR-200c Regulation of Pin1 3'UTR
Lentiviral Transduction of Mammalian Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!