Automated dna sequencing

Plasmids from positive phage clones were extracted using a DNA miniprep kit (Qiagen, Germany) and the DNA sequences were determined by automated DNA sequencing (Macrogen, Korea), using primers pMOD5’: 5′ CAG GAA ACA GCT ATG ACC 3′, and pMOD3’: 5′ CCC TCA TAG TTA GCG TAA CG 3′. The DNA sequence was analyzed with IgBLAST and the complementarity determining regions (CDRs) 1, 2, 3 were identified with IMGT software. For 3D structure modeling, the nucleotide sequence was translated to an amino acid sequence using ExPASy website. Homology modeling of the three-dimensional (3D) structures of yiN92-1e10 and yiDOA9-162 scFv antibodies was generated from the amino acid sequences using the SWISS-MODEL website. The server chose the template by sequence identity analysis. Thereafter, the sequence was processed by the server for modeling. The templates with the 79.57 and 70.76% sequence identity were chosen among three generated models from yiN92-1e10 and yiDOA9-162 scFv antibodies, respectively. Models were visualized with the program PyMOL (www.pymol.org).

To construct pUA66 with the stress promoters PrprA and PcpxP fused to the gene encoding mneongreen (mNG) [10 (link)], the promoter region of rprA and cpxP were amplified by PCR using pUC66-RprA-GFPmut (kindly provided by Tanneke den Blaauwen) and genomic DNA of the E. coli strain MG1655 as template, respectively (rprA; FW: TCGACTCGAGAATTGATATTTGCTTGCTCTTCC, RV: GCAGGATCCGAGCTAATAGTAGGCATACGGAC, cpxP; FW: CTCGAGAGACGTCGCTAATCCATGAC, RV: CGTTGAATCGCGACAGAAAGAGGATCCT). The primers were flanked by XhoI and BamHI restriction sites and the resulting PCR fragments were cloned into the XhoI/BamHI cut pUA66 already containing mNG, creating pUA66-PrprA-mNG and pUA66-PcpxP-mNG. The sequences of the plasmids were confirmed by automated DNA sequencing (Macrogen Europe).