Total RNA from spleen tissues was extracted using a Trizol reagent kit (Takara, Japan) according to the kit instructions. The RNA concentration was determined by measuring the optical density at 260 nm. Complementary DNA (cDNA) was synthesized with a PrimeScript™ II reverse transcriptase reagent kit (Takara, Japan) from 1 μg of total RNA. Quantitative Real-Time PCR was performed on a 7300 Real-Time PCR detection system (Applied Biosystems, Foster City, CA, USA) using a SYBR® Green PCR kit (Takara, Japan). The PCR procedure was set as 95°C, 30 s, 95°C, 5 s, and 60°C, 31 s, 40 cycles. Sample cDNAs (equivalent to 2 μg of total RNA) were regarded as templates with gene-specific primers. The PCR primer sequences were set as follows: TGF-β1: 5′-CATTGCTGTCCCGTGCAGA-3′(forward) and 5′-AGGTAA -CGCCAGGAATTGTTGCTA-3′ (reverse); M-CSF: 5′-GAATACTGAACCTGCCTGCTGAA-3′(forward) and 5′-AGGCCAGCTCAGTGCAAGAA-3′ (reverse); β-actin: 5′-GGAGATTACTGCCCTGGCTCCTA-3′ (forward) and 5′-GACTCATCGTACTCCTGCTTGCTG-3′ (reverse). β-Actin was used as the housekeeping gene. The expressions of target mRNAs were measured using the 2−ΔΔCt method and normalized to β-actin in arbitrary units.
7300 real time pcr detection system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
The 7300 real-time PCR detection system is a laboratory instrument designed for performing real-time polymerase chain reaction (PCR) analysis. The system is capable of detecting and quantifying nucleic acid sequences in real-time during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (8 mentions)
Rt2 sybr green qpcr primer assay, by Qiagen (4 mentions)
Innuprep rna mini kit, by Analytik Jena (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Taqman probe hs00193435 m1, by Thermo Fisher Scientific (2 mentions)
Kapa sybr fast quantitative pcr master mix, by Roche (2 mentions)
Cdna synthesis kit, by Takara Bio (2 mentions)
Trizol reagent kit, by Takara Bio (1 mentions)
Sybr green pcr kit, by Takara Bio (1 mentions)
Sybr premix ex taqtm 2, by Takara Bio (1 mentions)
β actin, by Sangon (1 mentions)
Power sybr mix, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Revertra ace, by Toyobo (1 mentions)
Takyon rox probe qpcr kit, by Eurogentec (1 mentions)
Primescript rt master mix, by Vazyme (1 mentions)
Sybr green master mix, by Vazyme (1 mentions)
Primescript rt reagent kit, by Thermo Fisher Scientific (1 mentions)
Hiscript 3 rt supermix, by Vazyme (1 mentions)
25 protocols using 7300 real time pcr detection system
1
Quantitative Analysis of RNA Expression
2
Antioxidant Gene Expression in Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reaction (PCR) was used to examine the genes expression of antioxidant enzyme system in macrophages on different alloy surfaces. Cells (2 × 105 cells per well) were seeded in a 6-well plate and cultured for another 5 days with complete culture solution. According to the manufacturer’s protocol, the total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and then reversely transcribed (Takara, Tokyo, Japan). Quantitative real-time PCR (qPCR) was performed with SYBR® Premix Ex TaqTM II (RR820A; Takara) in a total reaction volume of 20 μl containing 2.0 μl of cDNA template per well by the 7300 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA). β-Actin (B661302-0001; Sangon, China) was selected as an internal reference for normalization. The primer sequences were shown in Table 1 . When the amplification period ended, melting curve analysis was performed to confirm the specificity of the amplicon. Relative quantification of gene expression was calculated using 2−ΔΔCt equation. All data derived using qPCR was conducted in least three independent biological samples.
Primer sequences of target genes for real-time PCR in this study
| Gene | Primer sequence (F: forward; R: reverse) | Product size (bp) |
|---|---|---|
| Catalase (CAT) | F: GCAGATACCTGTGAACTGTCCCT | 172 |
| R: TTACAGGTTAGCTTTTCCCTTCG | ||
| β-Actin | F: GTGCTATGTTGCTCTAGACTTCG | 174 |
| R: ATGCCACAGGATTCCATACC |
3
Quantitative Analysis of Zebrafish mib2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained using RNAiso Plus (TaKaRa Bio, Japan) according to the manufacturer's protocol. Total RNA was reverse transcribed using ReverTra Ace (TOYOBO) according to the manufacturer's protocol. The zebrafish mib2 gene sequence was retrieved from the UCSC Genome Browser for real time PCR (http://genome.ucsc.edu/cgi-bin/hgGateway ). The primers were designed by Primer3web version 4.0.0 (http://primer3.ut.ee/ ). Primer specificity was confirmed by NCBI/Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ). The transcript levels of mib2 and Rpl13α were quantified by real-time PCR with Power SYBR Mix (Applied Biosystems) on a 7300 Real-Time PCR detection system (Applied Biosystems) as described previously (Itoh et al., 2014 (link)).
4
Quantifying Barley Root Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from barley root tissue was extracted according to Chang et al. [83 (link)]. cDNA was synthesised from 1 μg of the total RNA using a revert Aid First Stand cDNA Synthesis Kit (Biomatik; Wilmington, DE, USA) according to the manufacturer’s instructions. Primer3 Input (version 0.4.0) software [84 (link)] (http://frodo.wi.mit.edu/primer3/ ) was used to design gene specific primers (Table 4 ). The housekeeping gene actin of barley was used as the internal control. The qRT-PCR was performed on a 7300 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA) in a 30 μL volume containing 15 μL (2X) Maxima SYBR Green/ROX qPCR Master Mix (Biomatik; Wilmington, DE, USA), 2 µL cDNA template (50–100 ng), 1 µL (10 mM) of forward and reverse primers and 12 µL double-distilled H2O. PCR conditions were the following: 95 °C for 10 min, 40 cycles of 30 s at 95 °C, 60 °C for 1 min. The PCR was followed by a melt curve analysis by heating from 60 °C to 95 °C with increments of 0.5 °C/cycle. Relative gene expression was calculated according to the delta–delta Ct method [85 (link)]. Three biological replicates were performed for each experiment.
5
Quantitative Real-Time PCR Analysis of Gene Expression in Breast Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 48 h from siRNA transfection, total cellular RNA was isolated from SUM-149, MDA-MB 231, and MDA-MB-468 cells using innuPREP RNA mini-Kit (Analytik Jena AG, cat. no. 845-KS-2040050, Jena, Germany) and reverse transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, cat. no. 4368814, Foster City, CA, USA). Quantitative real-time PCR was performed in duplicate for each target gene using RT2 SYBR Green qPCR Primer Assay (Qiagen, cat. no. 330500, Hilden, Germany) and Takyon™ ROX probe qPCR Kit (Eurogentec GmbH, cat. no. UF-RPMT-B0100, Cologne, Germany) in a 7300 real-time PCR detection system (Applied Biosystems). The relative gene expression levels were assessed using the 2−ΔΔCt method after normalization to the β-actin gene as an internal control. Melting curve analysis was conducted to confirm specific product amplification. The following target genes were assessed: VEGF-A, F3, F7, IGFBP1, IGFBP2, EDN1, F2R, and F2RL1. Primer sequences are listed in Supplementary Table S1 .
6
Quantitative Gene Expression Analysis of Syndecans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qPCR) for both cell lines was performed, RT2 SYBR Green qPCR Primer Assay (Qiagen, cat. no. 330500, Hilden, Germany) and Takyon™ ROX probe qPCR Kit (Eurogentec GmbH, cat. no. UF-RPMT-B0100, Cologne, Germany) in a 7300 real-time PCR detection system (Applied Biosystems, Darmstadt, Germany). The relative gene expression levels were assessed using the 2−ΔΔCt method after normalization to GAPDH gene expression as an internal control. Melting curve analysis was conducted to confirm specific product amplification. Gene expression of SDC1, SDC2, and SDC4 was analyzed using the TaqMan probes Hs00174579 m1, Hs00161617 m1, and Hs00299807 m1 (Applied Biosystems, Darmstadt, Germany), respectively. mRNAs analyzed and primer sequences (confirmed by NCBI BLAST analysis) are listed in Table 2 .
7
Quantitative Analysis of HAS2 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using the InnuPREP RNA mini kit (Analytikjena, cat. no. 845-KS-2040250, Jena, Germany). It was transcripted into cDNA carried out with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, cat. no. 4368814, Foster City, CA, USA) following the supplier´s protocols. qPCR was performed in a 7300 real-time PCR detection system (Applied Biosystems) with RT2 SYBR Green qPCR Primer Assay (Qiagen, cat. no. 330500, Hilden, Germany) and Takyon™ ROX probe qPCR Kit (Eurogentec GmbH, cat. no. UF-RPMT-B0100, Cologne, Germany). HAS2 knockdown was confirmed using the TaqMan probe HS00193435 m1 (Applied Biosystems). Results were evaluated using the 2−∆∆Ct method. β-actin samples were used as internal controls. The fold change shows the expression of the investigated enzymes in HAS2 knockdown cells compared to the control samples. Primer sequences are shown in Supplementary Table S1. The results were formed out of 7 experiments with double or triple replicates in each experiment.
8
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIzol reagent (Invitrogen, USA). Total RNA was added to a reaction system and assayed using a PrimeScript RT master mix (Vazyme, China). mRNA was quantified using SYBR Green master mix (Vazyme, China) by a 7300 real-time PCR detection system (Applied Biosystems, USA). β-actin served as the internal normalization gene. The relative expression of the target genes was calculated as ΔΔCt. The mouse gene primers were summarized in Table 2 .
9
Renal TLR4/MyD88/NF-κB Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from renal tissue by using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, and the RNA was reverse transcribed to complementary DNA (cDNA) using the PrimeScript RT reagent kit and gDNA Eraser. The sequences of the primers are shown in Table 1 . RT-PCR was processed by a 7300 real-time PCR detection system (Applied Biosystems, Foster City, CA, USA). β-actin was used as a reference gene. The results of the real-time PCR were calculated by the 2-△△Ct method.
Primer sequences used in this study
| Target gene | Forward primer | Reverse primer |
|---|---|---|
| TLR4 | TCCTGTGGACAAGGTCAGCAAC | TTACACTCAGACTCGGCACTTAGCA |
| MyD88 | TACAGGTGGCCAGAGTGGAA | GCAGTAGCGATAAAGGCATCGAA |
| NF-кB | GAACGATAACCTTTGCAGGC | TTTCGATTCCGCTATGTGTG |
| β-actin | CATCCGTAAAGACCTCTATGCCAAC | ATGGAGCCACCGATCCACA |
10
HK-2 Cell Total RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TriZol reagent (Vazyme, China) was used to extract total RNA from HK-2 cells according to product specifications, and HiScript III RT SuperMix (Vazyme, China) was used to reverse transcribe mRNA. Then, PCR was conducted using a 7300 Real-time PCR detection system (Applied Biosystems, USA) with ChamQ Universal SYBR Qpcr Master Mix (Vazyme, China). The data were normalized to the expression of β-actin, and the relative expression of the target genes was calculated using the 2−ΔΔCT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!