The HIV-1 latently infected T7 or the uninfected THP1 monocytic cell lines were transfected with 10 ng/ml poly(I:C) (Sigma-Aldrich) in 12 well plates using lipofectamine3000 (Thermo), according to the manufacturer’s instructions (Ranganath et al., 2016 (link)). Bryostatin-1 (Sigma-Aldrich) at a final concentration of 25 ng/ml was included in the medium of T7 cells immediately after poly(I:C) transfection, followed by the addition of 10 μM of the protease inhibitor indinavir (Sigma-Aldrich) in respective wells. The cells were incubated in 5% CO2 at 37°C. After 48 h of incubation, mRNA was extracted from cells using RNeasy mini kit (QIAGEN). The amount and purity of the mRNA was assessed using NanoDrop One (Thermo Scientific) and stored at −80±C until further use. Reverse transcription was performed using ReverTra Ace qPCR-RT kit (TOYOBO). PCR reagents were purchased from Takara and the primers for IFNβ1 and ISG15 were obtained from Eurofins with the following sequences; IFNβ1 Fwd: GTCAGAGTGGAAATCCTAAG and IFNβ1 Rev: ACAGCATCTGCTGGTTGAAG (Hu et al., 2010 (link)) and ISG15 Fwd: CTCTGAGCATCCTGGTGAGGAA and ISG15 Rev: AAGGTCAGCCAGAACAGGTCGT (Matsunaga et al., 2020 (link)). The expression of genes was quantified using CFX96TM Real-time system (Bio-Rad) and normalized against the expression of β-actin in the corresponding cells.
Indinavir
Manufactured by Merck Group
Sourced in United States, Germany
Indinavir is a lab equipment product manufactured by Merck Group. It is a protease inhibitor used in the treatment and management of HIV/AIDS. The core function of Indinavir is to inhibit the activity of the HIV protease enzyme, which is essential for the replication of the virus.
Automatically generated - may contain errors
Lab products found in correlation
Ritonavir, by Merck Group (5 mentions)
Nelfinavir, by Merck Group (2 mentions)
Saquinavir, by Merck Group (2 mentions)
Amprenavir, by Merck Group (2 mentions)
Penicillin streptomycin, by Merck Group (2 mentions)
Sulfasalazine, by Merck Group (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Stf 31, by Merck Group (2 mentions)
Bryostatin 1, by Merck Group (1 mentions)
Poly 1 c, by Merck Group (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
Cfx96tm real time system, by Bio-Rad (1 mentions)
Wzb117, by Merck Group (1 mentions)
Xf24 apparatus, by Agilent Technologies (1 mentions)
2 deoxyglucose, by Merck Group (1 mentions)
Poly d lysine, by Merck Group (1 mentions)
Atazanavir, by Merck Group (1 mentions)
Abacavir, by Merck Group (1 mentions)
13 protocols using indinavir
1
Induction of IFNβ1 and ISG15 in HIV-1 Latency
2
Metabolic Profiling of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oxygen consumption and extracellular acidification rates, OCR and ECAR respectively, were measured on an XF24 apparatus from Seahorse Biosciences, as described previously (25). Briefly, all experiments were carried out in filter-sterilized DMEM reconstituted from powder formulation (Sigma, St. Louis, MO, USA) supplemented with 1 mM glutamine, but without sodium bicarbonate, phenol red, or serum, at a pH between 7.2 and 7.4 at 37 °C. Cells were seeded at a density of 1.5 to 2.0 × 105 per well by centrifugation in XF24 culture plates that were coated with poly-d -Lysine (Sigma). Glucose, 2-deoxyglucose (Sigma) and glucose transporter inhibitors (STF-31, GTI-2, and WZB117 from Merck; ritonavir and indinavir from Sigma) were injected to the indicated final concentrations. In each experiment, 6 wells were dedicated to each inhibitor concentration, 4 for dimethyl sulfoxide (DMSO) controls and 2 for background detection; titrations over six different concentrations were therefore conducted on two separate XF24 plates and cartridges for each donor. Data are represented as the average with error bars indicating the standard deviation.
3
Synthesis of HIV Protease Inhibitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The synthetic methods of nonpeptidic PIs, GRL-036, -121, and -139 were recently published (Ghosh et al., 2017 (link)), while GRL-142 was newly designed and synthesized. The method of synthesis of GRL-142 will be published elsewhere by A. K. Ghosh et al. DRV was synthesized as previously described (Ghosh et al., 2004 (link)). Saquinavir (SQV), indinavir (IDV), nelfinavir (NFV), ritonavir (RTV), tipranavir (TPV), amprenavir (APV), lopinavir (LPV), atazanavir (ATV), zidovudine (AZT), lamivudine (3TC), and abacavir (ABC) were purchased from Sigma-Aldrich (St. Louis, MO). Tenofovir disoproxil fumarate (TDF) was purchased from BioVision (Milpitas, CA).
4
Cell Culture Reagents and Materials
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phosphate buffered saline (PBS), trypsin- ethylenediamine tetraacetic acid, penicillin-streptomycin, and Dulbecco’s modified Eagle’s medium (DMEM) were purchased from Sigma Aldrich (St. Louis, MO, USA). FetalPlex was obtained from Gemini Bio-Products (Woodland, CA, USA). Horse serum was purchased from Gibco Technologies (Gaithersburg, MD, USA). 2,6-dichloroindophenol sodium salt (DPIP) was obtained from ICN Biomedicals Inc. (Aurora, OH, USA). Water-soluble tetrazolium salt 1 (WST-1) was obtained from Accela (San Diego, CA, USA). Phenazine methosulfate (PMS) was purchased from Acros Organics (Morris Plains, NJ, USA). D-glucose, phloretin, fasentin, STF-31, indinavir, and cytochalasin B were acquired from Sigma Aldrich (St. Louis, MO, USA). 5-Aminoimidazole-4-carboxamide-1-β-d -ribofuranoside (AICAR) was purchased from Toronto Research Chemicals (Toronto, ON, Canada). Goat anti-mouse and goat anti-rabbit secondary antibodies conjugated to horseradish peroxidase were obtained from Thermo Scientific (Rockford, IL, USA).
5
Glucose Metabolism and GLUT4 Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Glucose consumption and lactate production were measured using colorimetric glucose and lactate assay kits (BioVision, Milpitas, CA, USA) according to the manufacturer’s protocols. Briefly, cells from the designated experiments were incubated with assay buffer containing enzyme and glucose/lactate probes. Then, the optical densities were measured at 570/450 nm wavelengths. The glucose analog 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; Sigma, St. Louis, MO, USA) was also used to analyze glucose uptake. In addition, cells were treated with the GLUT4 transport inhibitors indinavir or ritonavir (Sigma, St. Louis, MO, USA) at 100 and 50 μM, respectively, for 60 min, and the uptake of 2-NBDG was measured using Vector 3 (Bruker, MA, USA) to detect relative fluorescence counts.
6
Recombinant Insulin Cell Treatments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Novo Nordisk Actrapid recombinant human insulin was used for cell treatments (Henry Schein, United Kingdom). ATPγS, PPADs, suramin, 5-BDBD, A-438079 were purchased from Tocris (Bristol, United Kingdom). Fluo-4 Direct and 50 x MEM amino acid solution were from Thermo Fisher Scientific (Loughborough, United Kingdom). ATP (adenosine 5’-triphosphate magnesium salt), apyrase, fatty acid-free BSA, palmitic acid and indinavir were purchased from Sigma Aldrich (Poole, United Kingdom).
7
Caco-2 Cell Line Transport Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Caco-2 (HTB-37) cells were obtained from ATCC, and transporter knockout cells (C2BBe1 clone) were provided by SOLVO Biotechnology (Szeged, Hungary). Zosuquidar was obtained from Stratech (Ely, UK). Ritonavir, valspodar, Fumitremorgin C, novobiocin, Ko143, MK571, indinavir, E3S, CDCF and sulfasalazine were purchased from Sigma-Aldrich, St. Louis, USA. DMEM media, FBS, non-essential amino acids and Penicillin-Streptomycin were obtained from Sigma-Aldrich (St. Louis, MO, USA). HBSS was obtained from Thermo Fisher Scientific. Cell culture plates were purchased from Merck, Millipore. Acetonitrile and Methanol were obtained from Biosolve and ROMIL.
8
Characterization of Drug Metabolism Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Uridine 59-diphosphoglucuronic acid trisodium salt (UDPGA), NADPH, alamethicin from Trichoderma viride, adenosine 3-phosphate 5-phosphosulfate, diclofenac sodium salt, midazolam hydrochloride, felodipine, S-(+)-mephenytoin, raloxifene hydrochloride, lovastatin, nisoldipine, nifedipine, methadone, quinidine, testosterone, benzydamine hydrochloride, cisapride, cyclosporin, terbutaline, sildenafil, verapamil, trazodone, atorvastatin, simvastatin, buspirone, rifabutin, saquinavir, terfenadine, zolpidem, repaglinide, indinavir, alprazolam, carbazeran, enalapril, ramipril , and dabigatran etexilate were purchased from Sigma-Aldrich (St. Louis, MO). NADPH-regenerating system containing NADP + , glucose-6phosphate, and glucose-6-phosphate dehydrogenase was purchased from Corning (Wiesbaden, Germany). Organic solvents were of LC-mass spectrometry (MS) or higher quality grade and were acquired from VWR International (Radnor, PA) or Fisher Scientific UK Ltd (Loughborough, UK). Purified water was obtained from Milli-Q Integral 5 Water Purification System (Merck KGaA, Darmstadt, Germany). Phosphate buffer, HQM Hepatocyte/Enterocyte Incubation Medium, and Co-Factor N for MetMax were purchased from In Vitro ADMET Laboratories (Columbia, MD).
9
Baculovirus-Expressed BCRP Transporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The baculovirus-infected insect cell microsomes (Supersomes) containing human complementary DNA-expressed BCRP (Arg482, 5 mg protein/mL) and wildtype Supersomes without hBCRP (control membrane, 5 mg protein/mL) used as negative control were obtained from Corning (Amsterdam, The Netherlands). After delivery, Supersomes were thawed at 37 °C, aliquoted, snap-frozen in liquid nitrogen, and stored at -80 °C until use.
AMP disodium salt, ADP sodium salt, ATP magnesium salt, guanosine 5'diphospate (GDP) sodium salt, uridine 5'-phosphate (UDP) sodium salt hydrate, sulfasalazine, sodium orthovanadate, amprenavir, indinavir, nelfinavir, ritonavir, saquinavir mesylate, ammonium acetate, MES hydrate, and Trizma base were obtained from Sigma-Aldrich (Taufkirchen, Germany), formic acid (MS grade) from Fluka (Neu-Ulm, Germany), acetonitrile, methanol (both LC-MS grade), and all other chemicals from VWR (Darmstadt, Germany).
Stock solutions were prepared in bidistilled water for sodium orthovanadate (10 mM), AMP, ADP, ATP, GDP, and UDP (20 mM, respectively) or in methanol for sulfasalazine (0.5 mg/mL), amprenavir, indinavir, nelfinavir, ritonavir, and saquinavir (1 mg/mL, respectively). Stock solutions were aliquoted and stored at -20 °C until use.
AMP disodium salt, ADP sodium salt, ATP magnesium salt, guanosine 5'diphospate (GDP) sodium salt, uridine 5'-phosphate (UDP) sodium salt hydrate, sulfasalazine, sodium orthovanadate, amprenavir, indinavir, nelfinavir, ritonavir, saquinavir mesylate, ammonium acetate, MES hydrate, and Trizma base were obtained from Sigma-Aldrich (Taufkirchen, Germany), formic acid (MS grade) from Fluka (Neu-Ulm, Germany), acetonitrile, methanol (both LC-MS grade), and all other chemicals from VWR (Darmstadt, Germany).
Stock solutions were prepared in bidistilled water for sodium orthovanadate (10 mM), AMP, ADP, ATP, GDP, and UDP (20 mM, respectively) or in methanol for sulfasalazine (0.5 mg/mL), amprenavir, indinavir, nelfinavir, ritonavir, and saquinavir (1 mg/mL, respectively). Stock solutions were aliquoted and stored at -20 °C until use.
10
Generation of HIV-specific T-cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HXTCs were generated as previously described (Sung et al., 2015a (link), Lam et al., 2015 (link)). Briefly monocytes were isolated from peripheral blood mononuclear cells (PBMCs) by plastic adherence. Dendritic cells were generated using standard cytokine cocktails of IL-4, GM-CSF, IL-1β, IL-6, and TNF-α. Non-adherent PBMCs were cryopreserved and thawed upon completion of dendritic cell generation. PBMCs were stimulated with irradiated autologous dendritic cells pulsed with Gag, Pol and Nef peptide pools in the presence of IL7, IL-15, and IL12 for an initial stimulation. Cells were then co-cultured with autologous PHA-treated blasts pulsed with Gag, Pol and Nef peptide pools in the presence of IL-15 and IL-2 for a second and IL-2 for a third round of stimulation. HIV peptide pools comprised 150, 15-mer peptides providing broad coverage of Gag p24, Pol, and Nef across clades (JPT Peptide Technologies). Irradiated K562 cells modified to overexpress the co-stimulatory molecules CD80, CD83, CD86 and 4-1BBL were used in the third stimulation. Cells were cultured in the presence of indinavir and raltegravir (Merck, Kenilworth NJ) to prevent replication of HIV.
HIV DART molecules (provided by Macrogenics) were used as previously described (Sung et al., 2015b (link), Sloan et al., 2015 (link)).
HIV DART molecules (provided by Macrogenics) were used as previously described (Sung et al., 2015b (link), Sloan et al., 2015 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!