Dnase treated

The replicon was further modified by insertion of modified sequences in the nontranslated 3′ UTR as described in Table 1. Replicon plasmids were linearized using NotI, and RNA transcripts were synthesized in vitro using T7 RNA polymerase (MEGAscript T7; Thermo Fisher Scientific) for 4 h. pTK-Ren (Promega) expressing Renilla luciferase was cotransfected as a transfection control. pTK-Ren was linearized using XbaI. RNA transcripts were DNase treated (Thermo Fisher Scientific) and cleaned with a RNA Clean and Concentrator column (Qiagen). RNA integrity was confirmed on agarose gels, and the concentration was determined with Qubit fluorometric quantitation (Thermo Fisher Scientific).
Cells were seeded at 2 × 10⁴ cells per well in 96-well plates and transfected with 50 ng of replicon and 10 ng of pTK-Ren using the transfection reagent Lipofectamine 2000 (Thermo Fisher Scientific). At the 6 h posttransfection, cells were washed with phosphate-buffered saline (PBS) and harvested in passive lysis buffer (Promega), and the luciferase activities were measured using the dual luciferase reagent kit and GloMax multidetection system (Promega). The firefly luciferase readings were normalized to the Renilla value for each sample. In some formats investigating effects of gene KO, luciferase expression was further normalized to that of the parental WT A549 cell line control.

Following treatments, RNA was extracted from differentiated 3T3-L1 pre-adipocytes using a RNeasy Mini Kit (Qiagen) according to the manufacturers protocol. RNA samples were DNase treated (Thermo) and cDNA was synthesised using MMLV reverse transcriptase (Promega). Quantitative real-time polymerase chain reaction was performed using a CFX384 qPCR system (Bio-Rad). Power SYBR green detection was measured using the following primers: pea-15 (FW-5′-GACCAACAACATCACCCTTGA-3′, RV-5′-TCTCCAGGAAGCTAAACCAGG-3′), ap2 (FW-5′-CAAACTGGGCGTGGAATTCG-3′, RV-5′-ACCAGCTTGTCACCATCTCG-3′), perilipin (FW-5′-CACTCTCTGGCCATGTGGAT-3′, RV-5′-AGAGGCTGCCAGGTTGTG-3′), adiponectin (FW-5′-TGTTCCTCTTAATCCTGCCCA-3′ 5′-CCAACCTGCACAAGTTCCCTT-3′) and were normalised to the GeoMean of reference genes ywhaz (FW-5′-GAAAAGTTCTTGATCCCCA-3′, RV-5′-TGTGACTGGTCCACAATTCCTT-3′), and nono (FW-5′-GCCAGAATGAAGGCTTGACTAT-3′, RV-5′-TATCAGGGGGAAGATTGCCCA-3′), using Pfaffl Equation for relative quantification.

RNA was extracted from cells using the QIAGEN RNeasy mini kit, DNase treated (Ambion) and cDNA synthesized using Superscript III (Invitrogen) according to the manufacturer’s instructions. QPCR was performed using a Stratagene Mx3005P detection system with SYBR Green incorporation with primers indicated below.

Gene	Forward Primer	Reverse Primer
TIP60	5′-CAATGTGGCCTGCATCCTA-3′	5′-ATGAACTCTCCAAAGTGGAAGG-3′
MOF	5′-AAGTCACGGTGGAGATCGG	5′- GCTGAAGTGATCCAGTCTCG-3′
actin	5′-CTCTTCCAGCCTTCCTTCCT-3′	5′- GAAGTGTGACGTGGACATCC −3′
INO80	5′-GCCCCCTTCCATGTGGTTAT-3′	5′-GGATCTTCCAACGAACACTGG-3′
BRCA2	5′-CCTGATGCCTGTACACCTCTT-3′	5′-GCAGGCCGAGTACTGTTAGC-3′
SRCAP	5′-CTACTCCAGGGCCCACTACT-3′	5′-AATGGGCGTCTTTACCTGGG-3′

All primer pairs spanned exon-intron boundaries and generated a single product as determined by dissociation curve analysis.

Total RNA was extracted using Trizol (Invitrogen) following the manufacturer’s instructions. Four micrograms of total RNA was DNase treated (Ambion Inc., Austin, TX) and converted to cDNA by the High Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA). PCR was performed in 96-well plates. Assays-on-Demand Gene Expression Taqman primers (Applied Biosystems) were used for PCR (Mm99999915_g1 for Gapdh; Mm00443147_m1 for Sema4d; Mm00555359_m1 for Plxnb1). Gapdh served as endogenous control. All primers were checked for equal efficiency over a range of target gene concentrations. Each sample was amplified in duplicate. PCR reaction mixture was run in Applied Biosystems Prism 7300 Sequence Detection System instrument utilizing universal thermal cycling parameters. Data analysis was done using relative quantification (ΔΔC_t) or the relative standard curve method. As per the manufacturer’s recommendation, any cycle threshold (C_t) values obtained below 33 were considered undetectable for that particular target gene.