Pcdna3 flag mettl3

Manufactured by Addgene

Sourced in United States

The pcDNA3/Flag-METTL3 is a plasmid vector that contains the coding sequence for the METTL3 protein, which is tagged with a Flag epitope. METTL3 is an enzyme responsible for the methylation of adenosine residues in messenger RNA (mRNA). This plasmid can be used for the expression and purification of the METTL3 protein in various cell lines.

Automatically generated - may contain errors

Lab products found in correlation

Pcdna3 flag mettl14, by Addgene (3 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions) Pcdna3 flag, by Addgene (2 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Gibson assembly cloning kit, by New England Biolabs (1 mentions) T4 dna ligase, by New England Biolabs (1 mentions) Pmirglo plasmid, by Promega (1 mentions) Sirna, by RiboBio (1 mentions) Gene synthesis, by Thermo Fisher Scientific (1 mentions) Z vad fmk, by Promega (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions) Puromycin, by Merck Group (1 mentions) Mg132, by Cayman Chemical (1 mentions) Px458 crispr, by Addgene (1 mentions) 1436 pcdna3 flag ha, by Addgene (1 mentions) On targetplus smartpool, by Horizon Discovery (1 mentions) Turbofect, by Thermo Fisher Scientific (1 mentions)

9 protocols using pcdna3 flag mettl3

Profiling Circular RNA Reporters with IRES

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The circRNA reporters containing split GFP^{11 (link)} were inserted with different human endogenous IRES, control sequences and putative m⁶A motifs using EcoRI and EcoRV cloning sites in the reporter (see Supplementary information, Table S1 for inserted sequences). The expression vector for FTO was constructed by cloning HA-tagged FTO cDNA into pcDNA5/FRT/TO using NheI and KpnI sites. The pcDNA3-Flag-METTL3 and pcDNA3-Flag-METTL14 plasmids were obtained from Addgene, and the pcDNA3-Flag-eIF4G2 expression vector is the generous gift from Dr Nahum Sonenberg.
293 and HeLa cells were cultured with DMEM medium containing 10% of FBS. To transiently express circRNA reporter, 293 cells were plated into 24-well plates 1 day before transfection. Of note, 1 μg of the plasmids was transfected using lipofectamine 2000 according to the manufacturer's manual. Transfected cells were collected 48 h after transfection for further RNA and protein analysis. For co-transfection, the circRNA reporter was transfected with protein overexpression plasmids in ratio 1:3.

Yang Y., Fan X., Mao M., Song X., Wu P., Zhang Y., Jin Y., Yang Y., Chen L.L., Wang Y., Wong C.C., Xiao X, & Wang Z. (2017). Extensive translation of circular RNAs driven by N6-methyladenosine. Cell Research, 27(5), 626-641.

+ Open protocol

+ Expand

Dual-reporter system for m6A regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

A DNA sequence carrying 10 GAL4 recognition motifs (or a scrambled version of the same sequence) was in vitro synthetized and cloned into pMirGlo plasmid (Promega) upstream to the constitutive PGK promoter by cutting with BglII and ligating with T4 DNA ligase (NEB). The sequence of SP2 known to harbor the m6A peak and the [GAN]_n motif was amplified by PCR and subcloned in frame at the N-terminus of Firefly luciferase by Gibson assembly (Gibson Assembly® Cloning Kit, NEB), using the ApaI site.
To generate GAL4-METTL3(CD) construct, The CREB coding sequence in plasmid pcDNAI-GAL4-CREB-S133A (Addgene #46770) was swapped with METTL3 catalytic domain obtained by plasmid pcDNA3/Flag-METTL3 (Addgene #53739) using restriction enzymes XbaI and EcoRI. Wild type METTL3, was mutagenized at the positions D394A (GAC / GCC) and W397A (TGG / GCG) as described by Fustin et al33 (link) with QuikChange II Site-Directed Mutagenesis Kit (Stratagene). Cloning primer sequences are listed in the supplementary material table.

Barbieri I., Tzelepis K., Pandolfini L., Shi J., Millán-Zambrano G., Robson S.C., Aspris D., Migliori V., Bannister A.J., Han N., De Braekeleer E., Ponstingl H., Hendrick A., Vakoc C.R., Vassiliou G.S, & Kouzarides T. (2017). Promoter-bound METTL3 maintains myeloid leukaemia via m6A-dependent translation control. Nature, 552(7683), 126-131.

+ Open protocol

+ Expand

Mettl3 Knockdown and Overexpression in H9c2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Mettl3 knockdown in H9c2 cells, the specific siRNA for Mettl3 (siMettl3) and negative control (siNC) were synthesized by RIBOBIO (Guangzhou, China). Cells were transfected with siMettl3 to knock down the expression of Mettl3. The knockdown of other target genes was also induced by siRNA transfection. Gene silencing was achieved by transfection of predesigned siRNA duplexes (Supplementary file 1) designed and synthesized by RIBOBIO (Guangzhou, China).
The coding sequence of Mettl3 was amplified from pcDNA3/Flag-METTL3 (Addgene, #53739) and inserted into the lentiviral plasmid pLOXCMV (Qi et al., 2015 (link)) to generate pLOX-Mettl3 overexpression plasmid. Viral particles were packaged in HEK 293T cells and used to infect H9c2 cells as previously described (Qi et al., 2015 (link)). The infected H9c2 cells were selected by puromycin and expanded to form a stable sub-line.

Jiang F.Q., Liu K., Chen J.X., Cao Y., Chen W.Y., Zhao W.L., Song G.H., Liang C.Q., Zhou Y.M., Huang H.L., Huang R.J., Zhao H., Park K.S., Ju Z., Cai D, & Qi X.F. (2022). Mettl3-mediated m6A modification of Fgf16 restricts cardiomyocyte proliferation during heart regeneration. eLife, 11, e77014.

+ Open protocol

+ Expand

Plasmid Constructs for FMDV Protease and LGP2 Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids encoding the WT or C51A mutant Lb protease were generated by PCR amplification of the corresponding regions from an FMDV O1K full-length cDNA clone [46 (link)] and insertion into the BamHI and XbaI sites of pcDNA3.1(+) (Invitrogen). Plasmids encoding the sequence of porcine LGP2 with a C-terminal Myc tag and/or an N-terminal DDK tag were generated by gene synthesis (NZYTech) and cloning into the NheI and XbaI sites of pcDNA3.1(+) (Invitrogen). Plasmid encoding (C-terminal Myc-DDK-tagged)-human LGP2 was from Origen. Plasmid pcDNA3/Flag-METTL3 encoding human methyltransferase-like 3 was from Addgene (# 53739).
For transfection, 2 μg of LGP2-encoding plasmids and 1 μg of plasmids encoding FMDV proteases were used using Lipofectamine 2000 (Invitrogen) following the manufacturer's recommendations. The total amount of transfected DNA was balanced to 3 μg with empty vector. In some experiments, the transfection medium was supplemented with 20 μM Puromycin (apoptosis inducer, Sigma-Aldrich), 20 μM zVAD-FMK (broad caspase inhibitor, Promega) or 10 μM MG132 (proteasome inhibitor, Cayman Chemical).

Rodríguez Pulido M., Sánchez-Aparicio M.T., Martínez-Salas E., García-Sastre A., Sobrino F, & Sáiz M. (2018). Innate immune sensor LGP2 is cleaved by the Leader protease of foot-and-mouth disease virus. PLoS Pathogens, 14(6), e1007135.

+ Open protocol

+ Expand

Plasmid Construction and Cell Transfection for ADAR1 and METTL3 Studies

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The wild-type ADAR1 plasmids ADAR1-p150 and ADAR1-p110 and the mutant-type ADAR1 plasmid ADAR1-p150-∆E/A were obtained from Dr. Qingde Wang [51 (link)]. pcDNA3-Flag-METTL3 (plasmid #53739) was purchased from Addgene (Cambridge, MA, USA). The luciferase reporter plasmid with 3′UTR containing either the sequence of the METTL3 mRNA (1401–1681) edited by ADAR1 (called the METTL3 MT plasmid) or not edited by ADAR1 (METTL3 WT) was constructed by inserting it into the psichake2 vector between the Hind III and the XbaI sites. All of the constructs were verified by sequencing. The miR-532-5p mimics, siRNAs and negative control were synthesized by Genepharma Inc. (Shanghai, China). The miR-532-5p mimics and siRNAs sequences are listed in Table S1. When cells were ∼60% confluent, cells were transfected with plasmids, miR-532-5p mimics or siRNAs in 24-well plates or 6 cm tissue culture dishes (BD Company, Franklin Lakes, NJ, USA) using Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA, USA), according to the manufacturer’s instructions.

Li Y., Wang N.X., Yin C., Jiang S.S., Li J.C, & Yang S.Y. (2022). RNA Editing Enzyme ADAR1 Regulates METTL3 in an Editing Dependent Manner to Promote Breast Cancer Progression via METTL3/ARHGAP5/YTHDF1 Axis. International Journal of Molecular Sciences, 23(17), 9656.

+ Open protocol

+ Expand

Generating TSC2 Knockout HeLa and HEK293E

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate TSC2 knockout in HeLa and HEK293E, small guide RNA (sgRNA) sequence targeting the -second exon of TSC2 was cloned into the PX458 CRISPR (Addgene, Plasmid # 48138) vector using the following oligonucleotide:
Forward: CACCGAACAATCGCATCCGGATGAT
Reverse: AAACATCATCCGGATGCGATTGTTC
48 hours after transfection, GFP positive cells were sorted into 96-well plates as single cell per well. Clonal cells were screened by immunoblotting with anti-TSC2 antibody. For siRNA experiments, nontargeting control pool (D-001810-10-20), RAPTOR (L-004107-00-0005), c-MYC (L-003282-02-0005), MAT2A (L-008818-00-0005), ATF4 (L-005125-00-0005), PPARγ (L-003436-00-0005), SREBF1 (L-006891-00-0005), SREBF2 (L-009549-00-0005), HSF1 (L-012109-02-0005), HSF2 (L-011874-00-0005), SAMTOR (L-016990-02-005), METTL3 (L-005170-02-0005), WTAP (L-017323-00-0005), and RICTOR (L-016984-00-0005) siRNAs (On TARGETplus SMARTpool) were acquired from Dharmacon and used at 35 nM (final concentration) with 6 μL of Lipofectamine RNAimax (Thermo fisher scientific # 13778150) (6-well plate) for each condition. The following plasmid constructs were used in this study; 1436 pcDNA3 Flag HA (Addgene #10792), pcDNA3/Flag-METTL3 (Addgene #53739), and pcDNA3/Flag-METTL14 (Addgene $53740). Cells were transfected with siRNA or plasmids for 48 hours before proceeding to specific treatments.

Villa E., Sahu U., O’Hara B.P., Ali E.S., Helmin K.A., Asara J.M., Gao P., Singer B.D, & Ben-Sahra I. (2021). mTORC1 stimulates cell growth through SAM synthesis and m6A mRNA-dependent control of protein synthesis. Molecular cell, 81(10), 2076-2093.e9.

+ Open protocol

+ Expand

Plasmid Construction and Lentiviral Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids pCDNA3-FLAG and pCDNA3-FLAG-METTL3 were purchased from Addgene (Cambridge, MA USA). The catalytically dead mutant of METTL3 was conducted from pCDNA3-FLAG-METTL3 by using QuikChange II Site-Directed Mutagenesis Kit (California, CA USA). The residues 395–398, DPPW, were mutated to APPA. The mutant primers were synthesized as follows: forward 5ʹ-AGTTGTGATGGCTGCCCCACCCGCGGATATTCACATGGAACTG-3ʹ; reverse 5ʹ- CAGTTCCATGTGAATATCCGCGGGTGGGGCAGCCATCACAACT-3ʹ.
Lipofectamine 2000 (Invitrogen, Carlsbad, CA USA) was used for transit transfection according to the instruction. Scramble and METTL3 shRNAs were purchased from Sigma Aldrich (St. Louis, MO USA).
The lentiviruses were packaged in 293T cells through co-transfection with pLP1, pLP2, and VSVG. Supernatants containing lentiviral particles was collected and concentrated by addition of PEG, and cells were transduced and selected with puromycin.

Cai J., Yang F., Zhan H., Situ J., Li W., Mao Y, & Luo Y. (2019). RNA m6A Methyltransferase METTL3 Promotes The Growth Of Prostate Cancer By Regulating Hedgehog Pathway. OncoTargets and therapy, 12, 9143-9152.

+ Open protocol

+ Expand

Plasmid Transfection in HeLa Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following plasmids have been described previously: pC97ELsLuc [36 (link), 37 ], pBELsLuc [36 (link), 37 ], pHPV16AN [36 (link), 37 ], and pX856F [38 (link)]. PcDNA3-FLAG-HA-hYTHDC1 (#85167), pcDNA3/Flag-METTL3 (#53739), pcDNA3/Flag-METTL14 (#53740), pcDNA3/Flag-WTAP (#53741), pFRT/TO/HIS/FLAG/HA-ALKBH5 (#38073) were purchased from Addgene. pcDNA3.1⁺/C-(K)DYK-FTO was purchased from GenScript. Transfections were made with Turbofect according to the manufacturer’s protocol (Fermentas). Briefly, a mixture of 2 µl Turbofect per 1 µg DNA and 100 µl of DMEM without serum was incubated at room temperature for 25 min prior to dropwise addition to 60-mm plates with subconfluent HeLa cells.

Cui X., Nilsson K., Kajitani N, & Schwartz S. (2022). Overexpression of m6A-factors METTL3, ALKBH5, and YTHDC1 alters HPV16 mRNA splicing. Virus Genes, 58(2), 98-112.

+ Open protocol

+ Expand

Generating Catalytically Dead METTL3

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids pCDNA3‐FLAG and pCDNA3‐FLAG‐METTL3 were purchased from Addgene. The catalytically dead mutant of METTL3 was conducted from pCDNA3‐FLAG‐METTL3 using QuikChange II Site‐Directed Mutagenesis Kit. The residues 395−398, DPPW, were mutated to APPA.

Zhang H., Wu D., Wang Y., Guo K., Spencer C.B., Ortoga L., Qu M., Shi Y., Shao Y., Wang Z., Cata J.P, & Miao C. (2023). METTL3‐mediated N6‐methyladenosine exacerbates ferroptosis via m6A‐IGF2BP2‐dependent mitochondrial metabolic reprogramming in sepsis‐induced acute lung injury. Clinical and Translational Medicine, 13(9), e1389.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!