Log In Sign up
The largest database of trusted experimental protocols

Cold fusion kit

Manufactured by System Biosciences
Visit Supplier
Sourced in United States

The Cold Fusion kit is a laboratory equipment product designed for the detection and analysis of specific molecular interactions or events. It provides the core functionality to facilitate these types of experiments and measurements, without making any claims about its intended use or applications.

Automatically generated - may contain errors

Lab products found in correlation

Phusion high fidelity enzyme, by New England Biolabs (2 mentions) Steponeplus, by Thermo Fisher Scientific (2 mentions) Pcdh mscv mcs ef1 gfp t2a pu, by System Biosciences (2 mentions) Bullseye evagreen qpcr sybr green mastermix, by MidSci (2 mentions) 4 hydroxytamoxifen, by Merck Group (2 mentions) Ab1791, by Abcam (2 mentions) Ab9484, by Abcam (2 mentions) β estradiol, by Merck Group (2 mentions) Sc 8002, by Santa Cruz Biotechnology (2 mentions) Phusion enzyme, by Thermo Fisher Scientific (1 mentions) Pcdh cmv msc ef1 copgfp, by System Biosciences (1 mentions)

Close spelling variants of this product

Cold Fusion Cloning Kit (22 citations) Cold Fusion (6 citations)

8 protocols using cold fusion kit

1

Dual gRNA ASIC1 Knockout Constructs

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
KO constructs using the dual gRNA approach41 (link) targeting ASIC1 exon 2 and 3, and donor for ASIC1 were described previously.5 (link) ASIC1 expression vector used for rescue experiments was constructed by cloning ASIC1-coding region into pCDH-Myc by Cold Fusion kit (System Biosciences, Mountain View, CA, USA). All PCR products were verified by DNA sequencing.
Chen B., Liu J., Ho T.T., Ding X, & Mo Y.Y. (2016). ERK-mediated NF-κB activation through ASIC1 in response to acidosis. Oncogenesis, 5(12), e279-.
+ Open protocol
+ Expand
2

Cloning and Engineering of ASIC1 Variants

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The high fidelity Phusion enzyme from NEB (Ipswich, MA) was used to amplify DNA fragments by PCR for cloning purpose. To clone Myc-ASIC1, we first amplified the ASIC1 coding region using primers ASIC1-Myc-R1-5.1 and ASIC1-Not1-3.1, and then cloned into pCDH-Myc by Cold Fusion kit (System Bioscience) as described previously (50 (link)). To make ASIC1-GFP fusion, we amplified GFP using primers PCDH-R1-5.1 and GFP-ASIC1-3.1, and the ASIC1 coding region using primers GFP-ASIC1-5.1 and ASIC1-Sal1-3.1, respectively. These two overlapping fragments were subsequently cloned into pCDH by Cold Fusion kit. Dual gRNA targeting ASIC1 exon 2 and 3, and ASIC1 donor were constructed using same method as described previously (21 (link)). For ASIC1 donor vector, we used primer sets ASIC1-left-BamH1-5.1 and ASIC1-left-BamH1-3.1 (left arm), and ASIC1-right-R1-5.1 and ASIC1-right-R1-5.1 (right arm). These two fragments were sequentially cloned into donor vector at BamH I and EcoR I sites. All amplified fragments were verified by DNA sequencing.
Gupta S.C., Singh R., Asters M., Liu J., Zhang X., Pabbidi M.R., Watabe K, & Mo Y.Y. (2015). Regulation of breast tumorigenesis through acid sensors. Oncogene, 35(31), 4102-4111.
+ Open protocol
+ Expand
3

Cloning and Engineering of ASIC1 Variants

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The high fidelity Phusion enzyme from NEB (Ipswich, MA) was used to amplify DNA fragments by PCR for cloning purpose. To clone Myc-ASIC1, we first amplified the ASIC1 coding region using primers ASIC1-Myc-R1-5.1 and ASIC1-Not1-3.1, and then cloned into pCDH-Myc by Cold Fusion kit (System Bioscience) as described previously (50 (link)). To make ASIC1-GFP fusion, we amplified GFP using primers PCDH-R1-5.1 and GFP-ASIC1-3.1, and the ASIC1 coding region using primers GFP-ASIC1-5.1 and ASIC1-Sal1-3.1, respectively. These two overlapping fragments were subsequently cloned into pCDH by Cold Fusion kit. Dual gRNA targeting ASIC1 exon 2 and 3, and ASIC1 donor were constructed using same method as described previously (21 (link)). For ASIC1 donor vector, we used primer sets ASIC1-left-BamH1-5.1 and ASIC1-left-BamH1-3.1 (left arm), and ASIC1-right-R1-5.1 and ASIC1-right-R1-5.1 (right arm). These two fragments were sequentially cloned into donor vector at BamH I and EcoR I sites. All amplified fragments were verified by DNA sequencing.
Gupta S.C., Singh R., Asters M., Liu J., Zhang X., Pabbidi M.R., Watabe K, & Mo Y.Y. (2015). Regulation of breast tumorigenesis through acid sensors. Oncogene, 35(31), 4102-4111.
+ Open protocol
+ Expand
4

Cloning Linc-RoR and miR-145 Mutants

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR reactions for cloning purpose used Phusion enzyme from ThermoFisher Scientific (Pittsburgh, PA, USA). Different fragments of Linc-RoR were cloned into pCDH-CMV-MSC-EF1-copGFP (System Biosciences) with a strategy described previously (13 (link)). For example, to clone Linc-RoR E4, we first amplified the entire exon 4 by PCR using primers RoR-E4-R1–5.1 and RoR-E4-Not1-3.2 (Supplementary Table S1) and then cloned into the designated vector at EcoR I and Not I sites using Cold Fusion kit (System Biosciences). To make miR-145 binding site mutant clones, we carried out a two-step amplification procedure as described previously (19 (link)), using primers RoR-miR145-BS1-m-5.1 and RoR-miR145-BS1-m-3.1; RoR-miR145-BS2-m-5.1 and RoR-miR145-BS2-m-3.1 (Supplementary Table S1). All PCR products were verified by DNA sequencing. RoR-E4 clone mutated at two putative binding sites was made through the gBlock method from IDT.
Huang J., Zhang A., Ho T.T., Zhang Z., Zhou N., Ding X., Zhang X., Xu M, & Mo Y.Y. (2015). Linc-RoR promotes c-Myc expression through hnRNP I and AUF1. Nucleic Acids Research, 44(7), 3059-3069.
+ Open protocol
+ Expand
5

HOTAIR Overexpression and Knockdown Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HOTAIR gene was amplified by RT-PCR and then cloned into a lentiviral vector pCDH-MSCV-mcs-EF1-GFP-T2A-Pu (SBI) at EcoR1 and Not1 sites using the Cold Fusion kit (SBI). To generate HOTAIR overexpression stable cells, cells were transduced with control or HOTAIR overexpression lentivirus particles and selected with puromycin for 3 days. HOTAIR knockdown construct was created by inserting oligo (CCGGGAACGGGAGTACAGAGAGAATCTCGAGATTCTCTCTGTACTCCCGTTCTTTTTG) into the pLKO.1 vector. Lentiviral particles were generated by transfecting 293T cells with packaging vectors, psPAX2 and pMD2.g. All primers were designed using Primer 3 and synthesized by Integrated DNA Technologies (Table S4). The qRT-PCR was performed using Bullseye EvaGreen qPCR SYBR Green Mastermix (MIDSCI) on an Applied Biosystems StepOne Plus. A detailed list of other plasmids and reagents used in this study is provided in the Supplemental Experimental Procedures.
Zhang A., Zhao J.C., Kim J., Fong K.W., Yang Y.A., Chakravarti D., Mo Y.Y, & Yu J. (2015). LncRNA HOTAIR Enhances the Androgen-Receptor-Mediated Transcriptional Program and Drives Castration-Resistant Prostate Cancer. Cell reports, 13(1), 209-221.
+ Open protocol
+ Expand
6

HOTAIR Overexpression and Knockdown Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HOTAIR gene was amplified by RT-PCR and then cloned into a lentiviral vector pCDH-MSCV-mcs-EF1-GFP-T2A-Pu (SBI) at EcoR1 and Not1 sites using the Cold Fusion kit (SBI). To generate HOTAIR overexpression stable cells, cells were transduced with control or HOTAIR overexpression lentivirus particles and selected with puromycin for 3 days. HOTAIR knockdown construct was created by inserting oligo (CCGGGAACGGGAGTACAGAGAGAATCTCGAGATTCTCTCTGTACTCCCGTTCTTTTTG) into the pLKO.1 vector. Lentiviral particles were generated by transfecting 293T cells with packaging vectors, psPAX2 and pMD2.g. All primers were designed using Primer 3 and synthesized by Integrated DNA Technologies (Table S4). The qRT-PCR was performed using Bullseye EvaGreen qPCR SYBR Green Mastermix (MIDSCI) on an Applied Biosystems StepOne Plus. A detailed list of other plasmids and reagents used in this study is provided in the Supplemental Experimental Procedures.
Zhang A., Zhao J.C., Kim J., Fong K.W., Yang Y.A., Chakravarti D., Mo Y.Y, & Yu J. (2015). LncRNA HOTAIR Enhances the Androgen-Receptor-Mediated Transcriptional Program and Drives Castration-Resistant Prostate Cancer. Cell reports, 13(1), 209-221.
+ Open protocol
+ Expand
7

HOTAIR Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
HOTAIR sequence was amplified by PCR and subsequently cloned into the expression vector pCDH-MSCV-mcs-EF1-GFP-T2A-Pu (SBI) at EcoR1 and Not1 sites using Cold Fusion kit (SBI). The shHOTAIR was cloned into the pLKO lentivirus system. All PCR primers for cloning are listed in Supplementary information (Table S3) and high fidelity enzyme Phusion was used for PCR amplification. All PCR products were verified by DNA sequencing. Specific antibodies used in this work include rabbit ER (06-935, Millipore), mouse ER (sc-8002, Santa Cruz), mouse GAPDH (ab9484, Abcam), rabbit H3 (ab1791, Abcam). Other reagents include beta-Estradiol (E8875, Sigma) and 4-Hydroxytamoxifen (H6278, Sigma-Aldrich). All primers were designed using Primer 3 and synthesized by Integrated DNA Technologies (Supplemental Table 3). QPCR was performed using SYBR Green by StepOne Plus in 3 technical replicates and significance was determined by two-sided t-tests. Each experiment was repeated independently at least two times. Western blotting was carried out using standard protocol and repeated at least two times. Band intensity on western blot was quantified with ImageJ and normalized to each respective control to obtain the ratio of ER protein level.
Xue X., Yang Y.A., Zhang A., Fong K.W., Kim J., Song B., Li S., Zhao J.C, & Yu J. (2015). LncRNA HOTAIR enhances ER signaling and confers tamoxifen resistance in breast cancer. Oncogene, 35(21), 2746-2755.
+ Open protocol
+ Expand
8

HOTAIR Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
HOTAIR sequence was amplified by PCR and subsequently cloned into the expression vector pCDH-MSCV-mcs-EF1-GFP-T2A-Pu (SBI) at EcoR1 and Not1 sites using Cold Fusion kit (SBI). The shHOTAIR was cloned into the pLKO lentivirus system. All PCR primers for cloning are listed in Supplementary information (Table S3) and high fidelity enzyme Phusion was used for PCR amplification. All PCR products were verified by DNA sequencing. Specific antibodies used in this work include rabbit ER (06-935, Millipore), mouse ER (sc-8002, Santa Cruz), mouse GAPDH (ab9484, Abcam), rabbit H3 (ab1791, Abcam). Other reagents include beta-Estradiol (E8875, Sigma) and 4-Hydroxytamoxifen (H6278, Sigma-Aldrich). All primers were designed using Primer 3 and synthesized by Integrated DNA Technologies (Supplemental Table 3). QPCR was performed using SYBR Green by StepOne Plus in 3 technical replicates and significance was determined by two-sided t-tests. Each experiment was repeated independently at least two times. Western blotting was carried out using standard protocol and repeated at least two times. Band intensity on western blot was quantified with ImageJ and normalized to each respective control to obtain the ratio of ER protein level.
Xue X., Yang Y.A., Zhang A., Fong K.W., Kim J., Song B., Li S., Zhao J.C, & Yu J. (2015). LncRNA HOTAIR enhances ER signaling and confers tamoxifen resistance in breast cancer. Oncogene, 35(21), 2746-2755.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!