Two ESCC cell lines EC9706 and EC109 were previously obtained from the Cell Bank of Shanghai Academy of Biological Sciences. One normal esophagus epithelial cell line Het-1A and three ESCC cell lines KYSE70, KYSE150 and KYSE450 were kindly provided by the Bioengineering and Transformation Laboratory of Zhengzhou University. Each cell line abovementioned was grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (Gibco, USA) and maintained in a cell incubator at 37 °C containing 5% CO2. Lentiviral vectors for gene knockdown (sh-ESCCAL-1#1 and sh-ESCCAL-1#2, sh-Gal-1#1 and sh-Gal-1#2) or overexpression (OE-ESCCAL-1, OE-Gal-1, OE-CDK4, OE-Smurf1) as well as the corresponding negative control vectors (sh-NC, OE-NC) were purchased from Shanghai GeneChem Company. The siRNAs used for Smurf1 knockdown (si-Smurf1#1 and si-Smurf1#2) were synthesized from Shanghai GenePharma Company and the sequence is shown in Supplementary Table 1 . Infection enhancer HitransG A (Shanghai Genechem, China), Lipofectamine 3000 (Invitrogen, USA), and transfection reagent INTERFERin (Polyplus, France) were employed to transfect lentiviral vectors, plasmids, and siRNAs into ESCC cells, respectively.
Hitransg a
Manufactured by Genechem
Sourced in China
The HitransG A is a laboratory equipment designed for the analysis and manipulation of genetic material. It serves as a core function for various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Hitransg p, by Genechem (4 mentions)
Puromycin, by Merck Group (3 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions)
Sh nc, by Genechem (2 mentions)
Puromycin, by Beyotime (2 mentions)
Mccoy 5a, by Procell (2 mentions)
Iscove modified dulbecco media (imdm), by Procell (2 mentions)
Hct116, by Procell (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Lentivirus, by Genechem (2 mentions)
Interferin, by Polyplus Transfection (1 mentions)
Oe nc, by Genechem (1 mentions)
Mir 130a 3p inhibitor, by GenePharma (1 mentions)
Mir 130a 3p mimic, by GenePharma (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
24 well plate, by Corning (1 mentions)
Ephrinb2, by Santa Cruz Biotechnology (1 mentions)
Hepg2, by Corning (1 mentions)
Smmc 7721, by Corning (1 mentions)
43 protocols using hitransg a
1
Establishment and Characterization of ESCC Cell Lines
2
Lentiviral Overexpression and Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Short-hairpin MBNL (sh-MBNL1) was constructed in a GV493 lentiviral vector, and sh-STAT3 was constructed in a GV248 lentiviral vector. Full-length MBNL1 and STAT3 genes were constructed in a GV492 lentiviral vector. All of the lentivirus and their respective negative controls were synthesized (Genechem, Shanghai, China). The miR-130a-3p mimics, miR-130a-3p inhibitor, and their respective negative controls were synthesized (GenePharma, Shanghai, China). The cells were seeded in 24-well plates (Corning), and transfection was performed until 80% confluency was reached. For lentivirus transfection, HitransG A (Genechem, catalog no. REVG003) was used according to the manufacturer's instructions to transfect cells with the lentivirus. The stable cell lines were selected using puromycin screening. For miRNA transfection, the cells were transfected with the miR-130a-3p mimics, miR-130a-3p inhibitor, or their respective negative controls using Lipofectamine 2000 Reagent (Invitrogen, catalog no. 11668019). The efficiency of transfection was analyzed using quantitative real-time polymerase chain reaction (qRT-PCR) or Western blot. The sequences for shRNAs and RNA oligoribonucleotides were as follows: sh-MBNL1 (5′-GCCAACCAGATACCCATAATA-3′), sh-STAT3 (5′-CGGCGTCCAGTTCACTACTAA-3′), and miR-130a-3p inhibitor (5′-AUGCCCUUUUAACAUUGCACUG-3′).
3
Chondrocyte PARP1 Silencing Optimization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chondrocytes (2×105 cells/well) were seeded into 96-well plates. A short interfering RNA (si)-negative control (NC), si-PARP1 #1 (positive virus 114447), si-PARP1 #2 (positive virus 114448) and si-PARP1 #3 (positive virus 114449) with green fluorescent protein were purchased from GeneChem, Inc. (Table I ). After 24 h, the viruses were stored at −80°C and taken out when required, placing on ice to thaw. The four viruses were individually diluted to an multiplicity of infection (MOI) of 100, 50 and 10 using complete medium. The culture media was discarded from cells, and using Nucleic acid transfection kit (Shanghai Genechem, Inc.) with nucleic acid concentration at 1×108 TU/ml and the effective transfection enhancers HiTransG A and HiTransG P (GeneChem, Inc.) were added according to the grouping, and mixed and cultured at 37°C, with 5% CO2, for 16 h. After transfection, the medium was replaced with 10% FBS DMEM, and cells were incubated at 37°C, with 5% CO2 for 48 h, and the transfection efficiency was evaluated under a fluorescence microscope. The transfection efficiency was calculated as follows: Transfection efficiency=(number of fluorescent cells/total number of cells) ×100. After singling out viruses with high transfection efficiency, the chondrocyte apoptosis model was replicated.
4
Lentiviral Transduction and Selection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviruses were purchased from Shanghai Genechem. Cells were seeded into 6-well plates. And they were transduced with the appropriate Lentiviruses when cells reached 50% confluence in the presence of HitransG A (Shanghai Genechem). We selected transduced cells using 2 ug/ml puromycin (Beyotime Institute of Biotechnology) and assessed transfection efficiency by RT-qPCR and western blotting.
5
Upregulation of Linc00963 in Prostate Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus infection and siRNA/miRNA transfection were performed as described previously (14 (link), 15 (link)). Briefly, for lentivirus infection, HiTransG A (Genechem) was used to facilitate infection of Lv-Linc00963/NC into PC-3 or C4-2 cells. Then, medium containing puromycin (Concentration: 2 μg/L) was used to selected PC-3 and C4-2 cells for two weeks in order to obtain stable Linc00963-upregulated cells. The stable Linc00963-upregulated cells were then collected for WB, RT-QPCR, CCK-8, EdU assays, and colony forming assays. TRIM24 siRNA, scrambled NC siRNA, miR-655 mimics, miR-655 inhibitors, and miR-655 NC were synthesized and provided by Ribo Bio (Guangzhou, China). For siRNA/miRNA transfection, Lipofectamine 2000 (ThermoFisher, USA) was used to transfect the siRNA (100 nM)/miRNA (50 nM) into PC-3 and C4-2 cells. Transfected cells were then harvested for RT-QPCR, CCK-8, WB, EdU assays, and colony forming assays 48 h later. The lentiviral and siRNA sequences are shown in Table 1
6
Lentiviral Knockdown of Ephrin-B Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviruses for the interference of ephrin-B1, ephrin-B2 and ephrin-B3 were all purchased from Santa Cruz (USA) with a titre of 1 × 108 TU/mL. The basic medium was used to prepare a suspension of primary astrocytes at a density of 5 × 106 cells/mL, and the cells were seeded in 6-cm petri dishes. When the inoculation density reached more than 90%, 400 μL of the virus infection enhancement solution HitransG A (GeneChem, China) and 100 μL of lentivirus or negative control (neg-control), each with a titre of 1 × 108 TU/mL, were added, and the cells were incubated at 37 °C for 24 h. After 72 h of virus infection, the cells were collected and identified by Western blot analysis to determine whether the target protein was knocked down.
7
Investigating Glioblastoma Cell Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The T98G cells and HMC3 cells were cultured in DMEM containing 10% fetal bovine serum and 1% penicillin/streptomycin. For siRNA knockdown, the T98G cells were transfected with ENO1-NC and ENO1 siRNA, (sequences listed in Supplementary Material S1 ) and transfection reagent for 48 h. For overexpression, ENO1/control lentivirus was added to the T98G cells with transfection reagent (40 µl HitransG A + 40 µl HitransG P, Genechem Co. Ltd., Shanghai, China). After transfection for 12 h, we replaced the transfection system with a fresh medium. Subsequently, T98G/si-ENO1-NC#, T98G/si-ENO1-1#, and T98G/si-ENO1-2 cells were co-cultured with HMC3 cells, the T98G cells, HMC3 cells were cultured in the upper and lower compartment, respectively. After 72 h, the cells were digested and collected for further analysis. The same methods were applied to T98G/Control, T98G/si-ENO1-1#, and T98G/si-ENO1-1-OE groups for the co-culture rescue experiment. The siRNA-knockdown and co-culture experiments were repeated independently three times.
8
Lentiviral Knockdown of PD-L1 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral vectors from Genechem encoding the control, shRNA, and PD‐L1 sequences were used to create stable transduction. The 5′‐CCCATTAATACTCTGGTTGAC‐3′ sequence was used to target PD‐L1. HitransG A (Genechem) was used to promote the transfection, according to the manufacturer's instructions. Cells (1 × 105) were sown into each well the day before and allowed to swell to 20%–40% confluence. An MOI of 20 was used to transfect the cells. After 72 h, the transfection efficiency was verified by fluorescence microscopy and RT‐PCR.
9
Huh-7 Cell Transduction with FABP1 Lentivirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Huh-7 cells were seeded into six-well plates and allowed to reach 30% confluency. Approximately 60 μl of HiTransG A (Genechem Co., Ltd., Shanghai, China), 4 μl 7 × 108 TU/ml LV-FABP1 lentivirus (Genechem Co., Ltd., Shanghai, China), and 4 μl 8 × 108 TU/ml FABP1 RNAi lentivirus (Genechem Co., Ltd., Shanghai, China.) were added into the 1.5 ml complete medium; the scramble sequence was used as a negative control (NC). After 12 h of incubation, the medium was replaced with complete medium for 72 h for subsequent experiments.
10
STAT1 Knockout in HCC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HCC cell lines SMMC7721 and HepG2 were obtained from the Zhong Qiao Xin Zhou Biotechnology (China). SMMC7721 cells were cultured in RPMI 1640 (Corning, Inc., Corning, NY, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (Corning, Inc., Corning, NY, USA) supplemented with 10% FBS and 1% penicillin-streptomycin. Cells were cultured at 37°C in 5% CO2. Lentivirus (GeneChem, Shanghai, China) was used for STAT1 knockout. The most appropriate multiplicity of infection was 10, as recommended by the protocol. Complete medium, HiTransG A (GeneChem, Shanghai, China), and Lentivirus were mixed and then added to inoculated cells on 6-well plates for transfection. After transfection for 16 h, the medium was replaced with complete culture medium containing 2.5 μg/mL puromycin, and the cells were incubated for 48 h. The concentration of puromycin was then successively reduced to complete the screening. The transfection efficiency was confirmed using western blot after 72 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!