C57 livers or cultured cells were homogenized or lysed in Trizol reagent with the help of the tissue lapping apparatus to extract total RNA. The total RNA was reverse-transcribed into cDNA by using the RevertAid First Strand cDNA Synthesis Kit. β-actin was used for internal reference. RT-qPCR was performed on the 7500 Real-time qPCR System (Applied Biosystems) with the SYBR Premix Ex Taq reagents. The primers of human genes used were listed in Table 1 .
7500 real time qpcr system
Manufactured by Thermo Fisher Scientific
Sourced in Japan, United States
The 7500 Real-Time qPCR System is a thermal cycler designed for real-time quantitative polymerase chain reaction (qPCR) experiments. It features a 96-well sample block and LED-based excitation and detection of fluorescent signals. The system is compatible with a variety of fluorescent detection chemistries.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Sybr green reagent, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq reagents, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Hieff qpcr sybr green master mix kit, by Yeasen (1 mentions)
Superscript 3 first strand synthesis system for rt pcr, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Taqman reverse transcription reagent, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Primescript rt pcr kit, by Takara Bio (1 mentions)
9 protocols using 7500 real time qpcr system
1
Quantitative Real-Time PCR for Gene Expression
2
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from indicated cells using RNAiso Plus (Takara, #9108Q), and the PrimeScript™ RT Master Mix (Takara, RR036A) was used to synthesize cDNAs according to the manufacturer’s instructions. Quantitative real-time PCR analyses were performed with SYBR Premix Ex Taq (Takara, Japan) on a 7500 Real-time qPCR system (Applied Biosystems) at the recommended thermal cycling settings: an initial cycle at 95 °C for 15 min followed by 40 cycles of 15 sec at 94 °C and 30 sec at 60 °C. Relative mRNA expression was calculated by normalizing with the β-actin gene expression according to 2(−ΔΔCt) method. Sequences of specific primers were listed below:β-actin:forward sequence GGATTCCATACCCAAGAAGGA; reverse sequence GAAGAGCTATGAGCTGCCTGA; GJB3: forward sequence CCTCCTCCTATGGACTGCCC; reverse sequence AAGGCCGTGAAGTCTGGGATA; β-ACTIN: forward sequence CATGTACGTTGCTATCCAGGC; reverse sequence CTCCTTAATGTCACGCACGAT;
3
Investigating Retinal Gene Expression in Albino Guinea Pigs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We evaluated the effect of exposure to full-spectrum LEDs and commercial cold-white LEDs on the expression of S-opsin, GRP78/Bip, ATF4, and CHOP mRNA in the retinas of albino guinea pigs. Individual intact retinas were isolated and homogenized using a rotor–stator homogenizer. The RNA in retinal tissues was extracted by TRIzol reagent (Sigma-Aldrich, St. Louis, MO). The expression of the target gene was detected by the 7500 Real-Time qPCR System (Applied Biosystems, Carlsbad, CA) with the Hieff qPCR SYBR Green Master Mix Kit (Yeasen Biotechnology Co., Ltd., Shanghai, China). Conditions for the real-time quantitative polymerase chain reaction (RT-qPCR) were as follows: 5 minutes at 95°C and then 10 seconds at 95°C, followed by two-step qPCR for 40 cycles consisting of 95°C for 15 seconds followed by 60°C for 35 seconds. The results are expressed relative to the β-actin internal control. The PCR primer sequences used are shown in the Table .
4
Quantifying Gene Expression in Femoral Head AC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from femoral head AC using TRIzol reagent (Invitrogen, Waltham, Massachusetts). Complementary DNA (cDNA) was synthesized using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, Massachusetts). Quantitative real-time reverse transcription-polymerase chain reactions were performed in triplicate using a 7500 Real-Time qPCR system and SYBR Green reagents (Applied Biosystems, Waltham, Massachusetts). Specific primers used for qPCR gene expression analyses are listed in Table I (see supplementary Table i for a full list of gene names). Gapdh expression levels were used as internal controls. Gene expression levels were relatively quantified using 2-∆∆Ct methods as described previously.7 (link),20 (link)
5
Quantitative RT-PCR Gene Expression Analysis
6
Quantification of Immune Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using the Arcturus® PicoPure® RNA Isolation Kit. High‐capacity cDNA Reverse Transcription Kits with RNase Inhibitor (Applied Biosystems) or the Super‐Script III First Strand Synthesis System for RT‐PCR (Invitrogen) were used for reverse transcription. Real‐time PCR was carried out with the following validated SYBR Green primer pairs: Cnb1 forward 5′-TGTTCCGTGCCTTGAGGTTG-3′, reverse 5′-TCTGTTCCTTATCGCCTTTGAC-3′; Nfat1 forward 5′-CTGGTCTACGGGGGCCAGCA-3′, reverse 5′-GGCAGGGACTGG GTGGTAGG-3′; Nfat2 forward 5′-TGCAAGCCAAATTCCCTGGTGG-3′, reverse 5′-GGGGTCGGGAGGCATGGTGA-3′; Il2 forward 5′-CCCAGGATGCTCACCTTC-3′, reverse 5′-CAACAGTTACTCTGATATTGCTGATG-3′; Gapdh forward 5′-TCGTCCCGTAGACAAAATGG-3′, reverse 5′-TTGAGGTCAATGAAGGGGTC-3′. Amplification was performed on a 7500 Real-Time QPCR system (Applied Biosystems) and the relative gene expression was calculated using the comparative Ct method (2−ΔΔCt).
7
Quantification of Gene Expression in DR and HRECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from DR tissues or high-glucose treated HRECs by Trizol reagent (Invitrogen corporation, Carlsbad, California, USA) according to the manufacturer’s instruction. The extracted total RNA was then reversely transcribed to complementary DNA (cDNA) by using TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, CA, USA). The SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) was employed to perform Real-Time qPCR to quantify the target cDNA by using the Applied Biosystems 7500 Real-Time qPCR System. The procedures were set as 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min according to the previous study. The primer sequences of the related genes are listed in the following Table 2 . The relative mRNA expression levels were normalized to β-actin by using the 2−ΔΔCt method.
The primers of the involved genes
| Gene | Primer sequences (strand) |
|---|---|
| β-Actin | Forward: 5′-CTCCATCCTGGCCTCGCTGT-3′ Reverse: 5′-GCTGCTACCTTCACCGTTCC-3′ |
| CKIP-1 | Forward: 5′-AATTCTGCGGGAAAGGGATTT-3′ Reverse: 5′-AACACCTCCTGACTGTTTTTCTC-3′ |
| Nrf2 | Forward: 5′-GACCTAAAGCACAGCCAACACAT-3′ Reverse: 5′-CTCAATCGGCTTGAATGTTTGTC-3′ |
8
Quantitative RT-PCR Analysis of Key Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from PBMCs at DPC 0 and TBLN at DPC 6 using TRIzol reagent (Invitrogen, CA, USA) as per the manufacturer’s instructions. NanoDrop™ 2000c Spectrophotometer (Thermo Fisher Scientific, MA, USA) was used to determine the concentration and purity of RNA. cDNA was prepared from 1 μg of total RNA using the QuantiTect Reverse Transcription Kit (AIAGEN). Primers of housekeeping gene (β actin) and target genes (T-bet and GATA-3) used in this experiment were described previously (36 (link)). The mRNA expression was analyzed by 7500 Real-Time qPCR system (Applied Biosystems, CA, USA) using the qScript™ One-Step SYBR Green qRT-PCR kit, Low ROX™ (Quantabio, MA, USA). The target gene expression level was normalized with housekeeping gene levels, and the fold change was determined by comparative 2−ΔΔCT method (37 (link)).
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNAiso Plus (Takara, #9108Q) and reverse transcribed using the PrimeScript RT-PCR kit (Takara, #RR600A) according to the manufacturer's instructions. Quantitative real-time PCR assays were performed using SYBR Premix Ex Taq (Takara, Japan) on a 7500 Real-time qPCR system (Applied Biosystems) at the recommended thermal cycling settings: an initial cycle at 95°C for 15 min followed by 40 cycles of 15 sec at 95°C and 30 sec at 60°C. Relative mRNA expression was calculated according to the 2 (-ΔΔCt) method. Speci c primer sequences are listed in the supplementary table.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!