Genejet dna extraction kit

Genomic DNA was extracted from the vancomycin-resistant clinical isolates using the Thermo Scientific GeneJET DNA Extraction Kit according to the instruction of the suppliers. After extraction, the purity of DNA was assessed using a spectrophotometer. The first PCR run was done using nuc gene primers TN1 (F.5′-GACTATTATTGGTTGATCCACCTG-3′) and TN2 (R.5′-GCCTTGACGAACTAAAGCTTCG-3′) with an expected product size of 218 bp. The PCR was performed in a total volume of 25 μl. The PCR amplification was performed as follows: initial denaturation step at 94°C for 4 min and then 35 cycles at 94°C for 1 min, 54°C for 1 min, and 72°C for 1 min. At the end, the PCR product was held at 72°C for 7 min. Furthermore, S. aureus ATCC 25923 was used as the positive control in this experiment [7 ].
The second PCR was multiplex PCR using vanA cluster genes using the specific vanA primers as shown in Table 1. The PCR condition using vancomycin resistance primers was an initial denaturation step at 94°C for 3 min followed by 40 cycles of DNA denaturation at 94°C for 30 sec, with annealing temperature for each pair of primers (as shown in Table 1) for 2 min, and DNA extension at 72°C for 2 min. After that, the PCR product was held at 72°C for 6 min and then stored at 4°C [10 (link)].

Genomic DNA was isolated from cells using the GeneJET DNA Extraction Kit (Thermo Fisher Scientific). PCR was performed on a Bio-Rad C1000 Thermal Cycler using the following conditions: 3 min at 95°C, 40 cycles of 20 s at 95°C, 30 s at 57°C, 30 s at 72°C and a final 5 min at 72°C using Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies). Relative DNA quantification was analysed by the 2^-ΔΔCt method. Primer sequences used are as follows:

Mouse CAD-F	AAGCTCAGATCCTAGTGCTAACG
Mouse CAD-R	CCGTAGTTGCCGATGAGAGG
Mouse 18S-F	ATGGTAGTCGCCGTGCCTAC
Mouse 18S-R	CCGGAATCGAACCCTGATT

DNA was extracted from cell samples using a GeneJet DNA extraction kit (ThermoFisher Scientific, USA) according to the manufacturer’s instructions. Sodium bisulfite treatment of genomic DNA was performed on 1000 ng of DNA using the Zymo Research EZ DNA methylation kit, according to the manufacturer’s recommended protocol for use on the Illumina Infinium MethylationEPIC 850K array. Cells harvested at 4 h and 72 h after cell cycle release were assessed for DNA methylation profiles using the Illumina methylationEPIC bead chip array. Methylated and non-methylated values were determined using the minfi pipeline, within R. To control for DNA methylation changes that occur naturally during cellular replication, the block-release protocol was performed on all cells together.