Kidney cortical and outer medulla samples were dissected, freshly frozen in liquid nitrogen, and stored at −80 °C until use. Total RNA was extracted with a mirVana miRNA Isolation Kit (Life Technologies, Thermo Fisher Scientific). For Fgf2 messenger RNA (mRNA) detection, reverse transcription was performed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) and polymerase chain reaction (PCR) was performed using the TaqMan Universal PCR Master Mix (Thermo Fisher Scientific). The Fgf2 and Gapdh quantitative PCR probe assays were purchased from Integrated DNA Technologies, Inc. For other real-time quantitative PCR, 1 mg of RNA was reverse transcribed using a cDNA Transcription Kit (Bio-Rad), and real-time quantitative PCR was performed using the SYBR Green PCR Master Mix (Bio-Rad). GAPDH was used for normalization. The sequences of the primers used for quantitative PCR are listed in the Table .
Cdna transcription kit
Manufactured by Bio-Rad
Sourced in United States
The cDNA Transcription Kit is a laboratory tool used to generate complementary DNA (cDNA) from extracted RNA samples. It provides the necessary reagents and protocols to perform reverse transcription, a process that converts RNA into single-stranded cDNA molecules.
Automatically generated - may contain errors
Lab products found in correlation
Mirvana mirna isolation kit, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Bio-Rad (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Rnaeasy kit, by Qiagen (1 mentions)
Genejet rna purification kit, by Thermo Fisher Scientific (1 mentions)
4 protocols using cdna transcription kit
1
Quantitative Analysis of Fgf2 mRNA Expression
2
Quantitative Analysis of CTGF mRNA in BUMPT Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described in our recent publications [32 (link),34 (link),35 (link)], the mirVana miRNA Isolation Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used for total RNA extraction from BUMPT cells. For quantitative real-time PCR (qPCR) to analyze gene expression, 1 μg total RNA was reversely transcribed using a cDNA Transcription Kit (Bio-Rad Laboratories, Hercules, CA, USA), and qPCR was performed using SYBR Green PCR Master Mix (Bio-Rad Laboratories, Hercules, CA, USA). The mRNA level of CTGF was normalized by GAPDH. The primer pair for CTGF was 5′-GTT ACC AAT GAC AAT ACC TTC TGC-3′ (forward) and 5′-TTG ACA GGC TTG GCG ATT-3′ (reverse). The primer pair for GAPDH was 5′-ACG GCA CAG TCA AGG CTG AG-3′ (forward) and 5′-GGA GGC CAT GTA GAC CAT GAG G-3′ (reverse). Fold change in expression was quantified using ΔCt values.
3
Quantification of Gene Expression in Tumor Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the tumors excised from mice using an RNAeasy kit (Qiagen, Valencia, CA, USA) according to the manufacture's protocol. One microgram RNA was then used for reverse transcription using a cDNA transcription kit (BioRad, Hercules, CA, USA). Then, Master Mix (Life Technologies, Pleasanton, CA, USA) was used for RT‐qPCR. The Ct data were processed using the average 2ΔΔCT method. GAPDH was used as control. CNOT4 prime: (F: CTCTACAGACTGGCAAGCAGC; R: CCTTTGGCGGTTGTAGTGTG). GAPDH prime: (F: TCCCATCACCATCTTCCAG; R: GGTTCACACCCATGACGAAC).
4
RNA Extraction and qRT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Kidney tissue samples were dissected, snap-frozen in liquid N2, and kept at -80°C until use. Total tissue RNA was extracted using a mirVana miRNA Isolation Kit (Thermo Fisher Scientific). BUMPT cell RNA was extracted using a GeneJET RNA Purification Kit (Thermo Fisher Scientific). To measure Tnfa mRNA, 2 μg RNA was reversely transcribed using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific), and real-time PCR (RT-PCR) was performed using TaqMan Universal PCR Master Mix (Thermo Fisher Scientific). Gapdh was used as an internal control. For the other mRNAs, 1 μg RNA was reversely transcribed using a cDNA Transcription Kit (Bio-Rad), and RT-PCR was performed using SYBR Green PCR Master Mix (Bio-Rad). β-Actin was used for normalization. The quantification was done using ΔCt values as recently described (45 (link), 46 (link)). Predesigned RT-PCR probes were used for mouse Tnfa and mouse Gapdh. The sequences of the other primers were shown in Table S1. All primers were synthesized at Integrated DNA Technologies Inc.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!