All DNA panel and antibody tag libraries were run on a Bioanalyzer High Sensitivity DNA electrophoresis chip (Agilent Technologies, cat. no. 5067-4626) to verify complete removal of primer-dimer products. Libraries were quantified by fluorometer (Qubit 3.0, Invitrogen) and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5′ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3′, Integrated DNA Technologies). The three-cell control sample was sequenced on an Illumina MiSeq using a v2 300-cycle kit in 2 × 150 bp paired-end mode (Illumina, cat. no. MS-102-2002). For the patient samples, DNA panel and antibody tag libraries were sequenced separately to maximize cost-effectiveness. DNA panels were sequenced with an Illumina NovaSeq 6000 SP 300-cycle Kit (Illumina, cat. no. 20027465) in 2 × 150 bp paired-end mode. Antibody tag libraries were sequenced with an Illumina NextSeq 550 75-cycle High Output Kit (Illumina, cat. no. 20024906) in paired-end mode, using 38 cycles for Read 1 and 39 cycles for Read 2.
Bioanalyzer high sensitivity dna electrophoresis chip
Manufactured by Agilent Technologies
The Bioanalyzer High Sensitivity DNA electrophoresis chip is a lab equipment product designed to analyze and quantify DNA samples. It utilizes microfluidic technology to separate and detect DNA fragments with high sensitivity, enabling the analysis of small sample sizes.
Automatically generated - may contain errors
Lab products found in correlation
Maxima h rt buffer, by Thermo Fisher Scientific (2 mentions)
Evos cell imaging system, by Thermo Fisher Scientific (2 mentions)
300 cycle v2 kit, by Illumina (1 mentions)
Next generation sequencing platform, by Illumina (1 mentions)
Qubit 3, by Thermo Fisher Scientific (1 mentions)
Phix control dna, by Illumina (1 mentions)
Nextseq 550 75 cycle high output kit, by Illumina (1 mentions)
Cutsmart, by New England Biolabs (1 mentions)
3 protocols using bioanalyzer high sensitivity dna electrophoresis chip
1
Next-Generation Sequencing of DNA Panels and Antibody Tags
2
Barcode Bead Cleavage and Imaging Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Barcode beads (2 μl) were resuspended in LS (10 mM Tris–HCl pH 7.5, 1 mM MgCl2, 50 mM NaCl, 0.1% Tween20) and incubated for 1 min. The beads were pelleted at 2000 g, the supernatant removed and the beads resusbended in 20 μl 1 × CutSmart (New England Biolabs), 1 × Maxima H- RT buffer (Thermo Scientific) or 1 × Kappa HiFi PCR buffer (Kapa Biosystems). For locally double-stranded cleavage tests pBB3 was added to a final concentration of 3 μM. Then, 0.4 μl USER II (New England Biolabs) enzyme mix was added an the suspension incubated for 45 min at 37 °C, and heat inactivated. FAM-probe pBB6 was added to a final concentration of 1 μM and the beads incubate at room temperature for 15 min under rotation. Beads were washed three times in 1 ml TET and imaged on a fluorescence microscope (EVOS cell imaging systems, Thermo Fisher) at constant light intensity, shutter speed and signal amplification.
For bioanalyzer traces 1 μl beads were resuspended in 20 μl CutSmart and released with 0.5 μl USER II by incubating 30 min at 37 °C. The Samples were diluted fourfold with water and 1 μl supernatant was loaded on a Bioanalyzer High Sensitivity DNA electrophoresis chip (Agilent Technologies).
For bioanalyzer traces 1 μl beads were resuspended in 20 μl CutSmart and released with 0.5 μl USER II by incubating 30 min at 37 °C. The Samples were diluted fourfold with water and 1 μl supernatant was loaded on a Bioanalyzer High Sensitivity DNA electrophoresis chip (Agilent Technologies).
3
Barcode Bead Cleavage and Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Barcode beads (2 μM of pr l) were resuspended in LS (10 mM Tris-HCl pH 7.5, 1 mM MgCl2, 50 mM NaCl, 0.1% Tween20) and incubated for 1 minute. The beads were pelleted at 2000g, the supernatant removed and the beads resusbended in 20 μM of pr l 1x CutSmart (New England Biolabs), 1x Maxima H-RT buffer (Thermo Scientific) or 1x Kappa HiFi PCR buffer (Kapa Biosystems). For locally doublestranded cleavage tests pBB3 was added to a final concentration of 3 μM of pr M. Then, 0.4 μM of pr l USER II (New England Biolabs) enzyme mix was added an the suspension incubated for 45 min at 37°C, and heat inactivated. FAM-probe pBB6 was added to a final concentration of 1 μM of pr M and the beads incubate at room temperature for 15 minutes under rotation. Beads were washed 3 times in 1 ml TET and imaged on a fluorescence microscope (EVOS cell imaging systems, Thermo Fisher) at constant light intensity, shutter speed and signal amplification.
For bioanalyzer traces 1 μM of pr l beads were resuspended in 20 μM of pr l CutSmart and released with 0.5 μM of pr l USER II by incubating 30 minutes at 37°C. The Samples were diluted 4 fold with water and 1 μM of pr l supernatant was loaded on a Bioanalyzer High Sensitivity DNA electrophoresis chip (Agilent Technologies).
For bioanalyzer traces 1 μM of pr l beads were resuspended in 20 μM of pr l CutSmart and released with 0.5 μM of pr l USER II by incubating 30 minutes at 37°C. The Samples were diluted 4 fold with water and 1 μM of pr l supernatant was loaded on a Bioanalyzer High Sensitivity DNA electrophoresis chip (Agilent Technologies).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!