PANC1 (human epithelioid carcinoma, epithelial-like, ATCC® CRL-1469™) was purchased from the American Type Culture Collection (ATCC) (Manassas, VA, USA). Cells were grown at 37°C with 5% CO2 and cultured with 1× Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS) and 5 μg/mL Plasmocin™. PANC1 cells resistant to GEM (PANC1-GEMR) were developed by culturing PANC1 cells in 1× DMEM containing 10% FBS and 5 μg/mL Plasmocin and gradually increasing the concentrations of GEM up to 0.01 μM. PANC1-GEMR cells are stable and have been cultured in conditioned medium containing 0.01 μM GEM for >3 years.
Atcc crl 1469
Manufactured by American Type Culture Collection
Sourced in United States
ATCC® CRL-1469™ is a cell line derived from human embryonic kidney cells. This product is intended for use in cell culture applications.
Automatically generated - may contain errors
Lab products found in correlation
Hpaf 2, by American Type Culture Collection (1 mentions)
Dulbecco s modified eagle s medium dmem, by Thermo Fisher Scientific (1 mentions)
Cellmask deep red plasma membrane stain, by Thermo Fisher Scientific (1 mentions)
Wst 1 reagent, by Roche (1 mentions)
2 2 azobis 2 methylpropionitrile aibn, by Merck Group (1 mentions)
Plasmocin, by InvivoGen (1 mentions)
4 cyano 4 phenylcarbonothioylthio pentanoic acid n succinimidyl ester, by Merck Group (1 mentions)
Methyl methacrylate, by Merck Group (1 mentions)
Poly ethylene glycol methyl ether methacrylate mn 300, by Merck Group (1 mentions)
Rnaimax kit, by Thermo Fisher Scientific (1 mentions)
Panc 1, by BD (1 mentions)
4 protocols using atcc crl 1469
1
Developing GEM-resistant PANC1 cells
2
Investigating PDAC Cell Response to TNF-α
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Authenticated human PDAC PANC-1 cell line (ATCC® CRL-1469™) and HPAF-II (ATCC® CRL-1997™) were acquired from American Type Culture Collection (Manassas, VA, USA) and provided by the laboratory of Dr. Wen-Hwa Lee of Genomics Research Center, Academia Sinica (Taiwan, Republic of China). Human PDAC PANC-1 and HPAF-II cells were cultured in 10% FBS DMEM. In this study, human PDAC cells were treated with TNF-α (50 ng/mL) in the presence or absence of 13-cis RA and 1, 25-VD3.
3
Nanomaterial-Based Pancreatic Cancer Therapy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oseltamivir phosphate was purchased from Hangzhou Dayang Chem Co Ltd (Hangzhou City, PRC). 4-Cyano-4-( phenylcarbo-nothioylthio)pentanoic acid N-succinimidyl ester (N-hydroxysuccinimide-protected RAFT agent or RAFT-NHS), 4-cyano-4-( phenylcarbonothioylthio)pentanoic acid >97%, poly(ethylene glycol) methyl ether methacrylate (M n 300), methyl methacrylate (MMA) ≤99%, 2,2′-azobis(2-methylpropionitrile) (AIBN) 98%, triethylamine (TEA), coumarin 153 (C153) dye content 99% were purchased from Sigma-Aldrich. N,N-Dimethylformamide anhydrous DrySolv® was purchased from EMD Millipore-AA-Corp., toluene reagent A.S.C. was purchased from ACP Chemicals Montreal, QC. Human pancreatic cancer cells PANC1 (human epithelioid carcinoma, epithelial-like, ATCC® CRL-1469™) were purchased from the American Type Culture Collection. Cell culture medium contain 1× Dulbecco's Modified Eagle's Medium (DMEM) purchased from Gibco, 10% fetal bovine serum (FBS) purchased from HyClone and 5 μg mL -1 Plasmocin™ purchased from InvivoGen. WST-1 reagent was purchased from Roche Diagnostics. CellMask™ Deep Red plasma membrane stain was purchased from Life Technologies Inc. Antibody to human neuraminidase 1 was purchased from Santa Cruz Biotechnology Inc.
4
Targeting Nucleolin in Pancreatic Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human pancreatic carcinoma cell line (PANC-1; ATCC® CRL-1469™) was obtained from the American Type Culture Collection (ATCC) and cultured in DMEM 10% FCS. For viability experiments, 1.5 × 105 PANC-1 cells per cm2 were plated at day 0 on 48-wells cell culture plate (Falcon). At 24 h, cells were treated by the investigated molecules in DMEM 5% FCS. Quantification of cells was performed using the blue Alamar assay (Sigma-Aldrich, St Quentin Fallavien, France). Small interfering RNA transfection was performed using RNAiMAX kit (InVitrogen) and 20 nM of nucleolin siRNA (sequence: CCACAAGGAAAGAAGACGAAG, Abnova corporation, France) or GFP siRNA, which was used as nontargeting control siRNA (Ambion, Thermofisher Scientific). Efficiency of si-nucleolin was controled by Western blot analysis and by immunohistology as previously described [8 (link)]. Mouse pancreatic ductal adenocarcinoma (mPDAC) were kindly provided by Douglas Hanahan's group (ISREC of Lausanne, Switzerland) [36 (link)], and cultivated as previously described [8 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!