Rnase free dnase set

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, France, Canada, Japan, Australia, Italy, China, Spain, Switzerland, Norway, Belgium, Sweden

The RNase-Free DNase Set is a laboratory equipment product designed for the removal of DNA contamination from RNA samples. It provides a convenient solution for the effective elimination of DNA from RNA preparations, ensuring the purity and integrity of RNA samples for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

2 366 protocols using rnase free dnase set

RNA Extraction and RT-qPCR from Cells and Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Culture cells were lysed by RLT lysis buffer (QIAGEN) with 1% (vol/vol) 2-mercaptoethanol (Nacalai Tesque), and total RNA was extracted from lysates using RNeasy Mini Kit (QIAGEN) and treated with RNase-Free DNase Set (QIAGEN) to remove genomic DNA. For RNA extraction from muscles, tissues were resected after euthanizing mice by CO₂ and homogenized using Multi-Beads Shocker (Yasui Kikai Corporation) according to the manufacturer’s instructions. Total RNA was extracted from homogenized tissues using Sepasol-RNA I Super G (Nacalai Tesque) and RNeasy Mini Kit (QIAGEN) and treated with RNase-Free DNase Set (QIAGEN) to remove genomic DNA. RNA concentration was measured using NanoDrop, and 0.5–1 μg of total RNA was reverse-transcribed to single-stranded cDNA using ReverTra Ace RT-qPCR Master Mix (TOYOBO). All RNA and cDNA samples were restored at −80°C for subsequent experiments. Quantitative PCR (RT-qPCR) was performed with SYBR Green Master Mix (TOYOBO) on the StepOnePlus instrument (Applied Biosystems) following the manufacturer’s instructions. RT-qPCR data were analyzed according to the 2-^ΔΔCt method and are presented as the mean of fold changes compared with the level of the housekeeping gene beta-actin (ACTB). The primer sequences used in this study are listed in Table S1.

Table S1 Primers for RT–qPCR.

Sun L., Jin Y., Nishio M., Watanabe M., Kamakura T., Nagata S., Fukuda M., Maekawa H., Kawai S., Yamamoto T, & Toguchida J. (2024). Oxidative phosphorylation is a pivotal therapeutic target of fibrodysplasia ossificans progressiva. Life Science Alliance, 7(5), e202302219.

+ Open protocol

+ Expand

Quantifying RNA Expression in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

For validation of Multi-miR shRNAs in NIH/3T3 cells, total RNA from cells was extracted using The RNeasy Kit and RNase-Free DNase Set (Qiagen) according to the manufacturer’s instructions. For Multi-miR mediated inhibition of tumor suppressor genes in the mouse liver, total RNA from liver tumors was extracted using the AllPrep DNA/RNA Micro Kit and RNase-Free DNase Set (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was prepared from 1 μg total RNA using Taqman reverse transcription kit (Applied Biosystems, #N808-0234) with random hexamers. For comparison of LT3GEPIR and pCF806 efficacy, RNA isolation and cDNA generation was performed using the Cells-to-CT kit (Invitrogen, #4402954), per the manufacturer’s instructions. qRT-PCR analyses were carried out in technical triplicate using SYBR green (Applied Biosystems) and specific primers (Table S1). Measurements were carried out using the ViiA seven system (Life Technologies) or a QuantStudio five Real-Time PCR machine (Thermo Fisher Scientific). The mRNA expression levels were normalized to the levels of mouse Actb mRNA, or human GUSB mRNA, and quantified using the comparative C_T method.

Amen A.M., Loughran R.M., Huang C.H., Lew R.J., Ravi A., Guan Y., Schatoff E.M., Dow L.E., Emerling B.M, & Fellmann C. (2022). Endogenous spacing enables co-processing of microRNAs and efficient combinatorial RNAi. Cell Reports Methods, 2(7), 100239.

+ Open protocol

+ Expand

Transcriptome Analysis of Fish Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fish were obtained from commercial breeders and euthanized with an overdose of MS-222. Experiments were performed in accordance with animal research regulations (Regierungspräsidium Freiburg, Baden Württemberg, Germany, Reference number: G-17/110). Skin, brain (both RNA-seq, cDNA sequencing), liver, eye, and muscle tissue (all cDNA sequencing) were dissected and kept in RNAlater (Invitrogen) at 4 °C overnight and transferred to −20 °C for long-term storage. RNAlater was removed prior to homogenization. Skin samples and appropriate amount of TRIzol (Invitrogen) (1 ml TRIzol per 0.1 g sample) were homogenized in 2 ml lysing matrix A tube (MP Biomedicals) using FastPrep-24 Classic Instrument (MP Biomedicals). RNA was extracted according to the manufacturer’s recommendations with additional 75% ethanol wash one time. Subsequent purification and on-column DNase treatment was performed with RNeasy Mini Kit (Qiagen) and RNase-Free DNase Set (Qiagen). The other organs were extracted using RNeasy Mini Kit (Qiagen). DNA was removed using RNase-Free DNase Set (Qiagen) according to the manufacture’s protocol. Following extraction and purification, RNA was quantified using the Qubit RNA HS Assay Kit (Invitrogen) with a Qubit Fluorometer (Life Technologies). First-strand cDNA was synthesized using 1 μg total RNA and the GoScript Reverse Transcription System (Promega).

Kratochwil C.F., Liang Y., Urban S., Torres-Dowdall J, & Meyer A. (2019). Evolutionary Dynamics of Structural Variation at a Key Locus for Color Pattern Diversification in Cichlid Fishes. Genome Biology and Evolution, 11(12), 3452-3465.

+ Open protocol

+ Expand

Isolation of Endoneurial Microvascular RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from endoneurial microvessels dissected with the Arcturus XT system using the Arcturus Pico Pure Isolation Kit (Thermo Fisher Scientific), according to the manufacturer’s directions. Caps were heated at 42 °C for 35 minutes (using Pico Pure extraction buffer (XB)) for 15 minutes with membrane removal using RNaseZap-treated forceps and placed in bottom of tube in XB for additional 20 minutes. Following RNA binding to the column, an on-column DNase digestion for 15 minutes using 80 μL DNase Mixture (Qiagen RNase-free DNase Set, catalog number 79254) was performed to remove contaminating genomic DNA. RNA was eluted using 20 μL RNase-free water supplied with the kit. RNA from endoneurial microvessels dissected with the Leica system was extracted using the miRNeasy kit (Qiagen, Hilden, Germany, catalog 217084), according to the manufacturer’s instructions. On-column DNase digestion was also performed to remove contaminating genomic DNA using the RNase-free DNase Set (Qiagen, catalog79254). Isopropanol-containing RNA was eluted using RNase-free water. Extracted RNA was stored at −80 °C prior to further use.

Palladino S.P., Helton E.S., Jain P., Dong C., Crowley M.R., Crossman D.K, & Ubogu E.E. (2017). The Human Blood-Nerve Barrier Transcriptome. Scientific Reports, 7, 17477.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands) or the NucleoSpin RNA XS kit (Takara Bio) according to the manufacturer’s instructions. RNase-free DNase Set (Quiagen) was used for DNase digestion during RNA purification. RNA quantity and quality were assessed by nano drop for RNA isolated from tissues and with the Aglient RNA 6000 Pico kit (Aglient Technologies) on the Aglient 2100 Bioanalyzer for RNA of FACS-purified cells. cDNA was generated from 1μg of total RNA per sample using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Quantitative real-time TaqMan PCR was performed using the following TaqMan primers: (Applied Biosystems: Actb (Mm00607939_s1), Hcrt (Mm01964030_s1), HcrtR1 (Mm01185776_m1), HcrtR2 (Mm01179312_m1), Csf1 (Mm00432686_m1), Pmch (Mm01242886_g1), Tph2 (Mm00557715_m1), Agrp (Mm00475829_g1), Galp (Mm00626135_m1), Ghrl (Mm00612524_m1), Gad1 (Mm04207432_g1), Npy (Mm01410146_m1), Pomc (Mm00435874_m1), LepR (Mm00440181_m1), Clock (Mm00455950_m1), Arntl2 (Mm05549497_m1), NR1d2 (Mm01310356_g1), Csf2 (Mm01290062_m1), IL-1β (Mm00434228_m1), CCL2 (Mm00441242_m1), IL-6 (Mm00446190_m1), MPO (Mm01298424_m1), Dpny (Mm00457573_m1). PCR was run on a 7500 thermal cycler (Applied Biosystems, Foster City, CA). Gene expression was normalized to βactin and quantified with the 2^ΔΔCT method.

McAlpine C.S., Kiss M.G., Rattik S., He S., Vassalli A., Valet C., Anzai A., Chan C.T., Mindur J.E., Kahles F., Poller W.C., Frodermann V., Fenn A.M., Gregory A.F., Halle L., Iwamoto Y., Hoyer F.F., Binder C.J., Libby P., Tafti M., Scammell T.E., Nahrendorf M, & Swirski F.K. (2019). Sleep modulates hematopoiesis and protects against atherosclerosis. Nature, 566(7744), 383-387.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from freshly collected cells, blastocysts or tissues using the RNeasy Mini Kit (74104, Qiagen) and DNase treated with the RNase-Free DNase Set (79254, Quiagen). After extraction, RNA was quantified using the Qubit RNA BR Assay Kit (Q10211, Invitrogen) and reverse transcribed using SuperScript III Reverse Transcriptase (18080044, Invitrogen). PCR was performed using the GoTaq Hot Start Green Master Mix (M5122, Promega) followed by agarose gel electrophoresis stained with ethidium bromide. RNA extraction, RNA quantification, cDNA synthesis, and PCR were performed according to the manufacturer’s protocols. The PrimerQuest Tool (Integrated DNA Technologies) was used to design primers (Table S1) spanning an exon-exon junction. Hydroxymethylbilane synthase gene (HMBS) was used as a housekeeping control.
Quantitative gene expression analysis was performed by qPCR using PowerUp SYBR Green Master Mix (A25742, Applied Biosystems) in a QuantStudio 3 Real-Time PCR System (A28137, Applied Biosystems) according to manufacturer’s protocol. Two independent samples were run in technical duplicates and relative expression was calculated by the comparative Ct method, normalizing values to the expression of HMBS housekeeping gene.

Soto D.A., Navarro M., Zheng C., Halstead M.M., Zhou C., Guiltinan C., Wu J, & Ross P.J. (2021). Simplification of culture conditions and feeder-free expansion of bovine embryonic stem cells. Scientific Reports, 11, 11045.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Quantifying Gene Expression in Transduced T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from flow cytometry-sorted positively transduced T cells was extracted using the RNeasy Mini Kit including the RNase-free DNase Set (Quiagen). RNA was transcribed into cDNA employing the SuperScript III First-Strand Synthesis SuperMix for qRT-PCR (Thermo Fisher Scientific). Quantitative real-time PCR analysis was performed using a TaqMan-based expression assay (Applied Biosystems). Reactions were performed in triplicates using the Applied Biosystems StepOnePlus Real-Time PCR system. Results were analyzed using the StepOne software (v2.3). The expression of a gene of interest (GOI) was calculated relative to the expression of Gapdh/GAPDH for calculation of Ebag9 levels. For genes involved in metabolism, SDHA was used as a housekeeping gene. A list of all TaqMan primers is presented in supplemental information, reagents table.

Wirges A., Bunse M., Joedicke J.J., Blanc E., Gudipati V., Moles M.W., Shiku H., Beule D., Huppa J.B., Höpken U.E, & Rehm A. (2022). EBAG9 silencing exerts an immune checkpoint function without aggravating adverse effects. Molecular Therapy, 30(11), 3358-3378.

+ Open protocol

+ Expand

Quantitative Analysis of Robo Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RNA extraction E12.5 mouse brains were dissected in cold RNase free medium and tissue blocks were vibratome cut at 250μm. Living cortical slices were further microdissected with microscalpels in ice-cold RNase free medium to isolate pieces from OB and the adjacent NCx. Tissue pieces were immediately frozen in liquid nitrogen for RNA extraction. Total RNA from each region was extracted using RNeasy Mini Kit (Quiagen) followed by treatment with RNase-Free DNase Set (Quiagen). Template cDNA was generated using Maxima First Strand cDNA Synthesis Kit for quantitative real-time PCR (qRT–PCR; Thermo Fisher). Primers used were:
msRobo1-Fw: CCTTCAGACCTGATCGTCTCC
msRobo1-Rv: TGAGCGCGGGTCATCTTTG
msRobo2-Fw: CTTTGAACGACCCACATTTCTCA
msRobo2-Rv: TCTCAGCGTGTAGTCATCTTTGA
ms18S-Fw: CGGCTACCACATCCAAGGAA
ms18S-Fw: GCTGGAATTACCGCGGCT
For comparison between species RNA was extracted from 6dpo chicken brains, dissected in cold RNase free medium and tissue blocks were vibratome cut at 250μm. Primers used in the mouse and chicken comparison are listed below:
ckROBO1-Fw AGAAGATTTCCCACCTCG
ckROBO1-Rv CTTGCCACGCAGACATAG
ckGAPDH –Fw GTGGTGCTAAGCGTGTTATCATC
ckGAPDH –Rv GGCAGCACCTCTGCCATC
msGAPDH_Fw CTCTTGCTCAGTGTCCTTGCTG
msGAPDH_Rv ATGAATACGGCTACAGCAACAGG

Cárdenas A., Villalba A., de Juan Romero C., Picó E., Kyrousi C., Tzika A.C., Tessier-Lavigne M., Ma L., Drukker M., Cappello S, & Borrell V. (2018). Evolution of Cortical Neurogenesis in Amniotes Controlled by Robo Signaling Levels. Cell, 174(3), 590-606.e21.

+ Open protocol

+ Expand

Gene Expression Analysis via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and purified using RNeasy^® Mini Kit (Qiagen), following manufacturer’s protocol. DNA was removed during RNA purification using RNase-Free DNase Set (Quiagen). RNA quality and quantity were analysed on the Agilent 2100 Bioanalyser (Agilent Technologies). Reverse transcription of extracted mRNA was performed using the ImProm-II^™ Reverse Transcription System (Promega). Real-Time PCR was performed using StepOnePlus^™ instrument (Applied Biosystems^®, Life Technologies) and data were analysed with StepOne Software. The 25 μl reaction contained Quanti Fast SYBR Green (Quiagen), primers in a final concentration of 0.2 μM each and 12.5 ng cDNA. The expression of target genes was normalised to the geometric mean of the expression of β-actin and cyclophilin, which were used as reference genes. The expression (or fold change) of the target gene relative to the control (cells maintained in CTR medium at 20% O₂ at day 7) was calculated with the 2^−∆∆Ct method. Primers were designed using Primer-BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and they were analysed using OligoAnalyzer 3.1 (http://eu.idtdna.com/calc/analyzer) and Primer3 (http://bioinfo.ut.ee/primer3-0.4.0). Primers used can be found in Table S1.

Cigognini D., Gaspar D., Kumar P., Satyam A., Alagesan S., Sanz-Nogués C., Griffin M., O’Brien T., Pandit A, & Zeugolis D.I. (2016). Macromolecular crowding meets oxygen tension in human mesenchymal stem cell culture - A step closer to physiologically relevant in vitro organogenesis. Scientific Reports, 6, 30746.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!