Sybr green pcr kit

Manufactured by Takara Bio

Sourced in Japan, China, United States, Switzerland, Germany, United Kingdom

The SYBR Green PCR kit is a reagent designed for real-time quantitative PCR (qPCR) experiments. It contains the necessary components, including SYBR Green I dye, to perform PCR amplification and detection of DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SYBR Green (1328 citations) SYBR Green kit (375 citations) SYBR green PCR mixture kits (2 citations)

915 protocols using sybr green pcr kit

RNA Extraction and Quantification of Intestinal Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from the jejunum was extracted with RNAiso Plus (Takara,
China) and quantified by spectrophotometry (NanoDrop ND-1000, Thermo Scientific,
USA). The CDNA was synthesized by RNA, according to the instructions for the use
of manufacturer’s enzymes (Takara, China). One microgram of total RNA was
reacted with a PrimeScript RT Reagent Kit (Takara, China) according to the
manufacturer’s instructions. Quantifications of the target genes Jagged1
(Jag1), delta-like-4 (Dll4), Notch1, hairy and enhancer of split-1 (Hes1), and
mouse atonal homolog 1 (Math1) and a housekeeping gene (GAPDH) in cDNA samples
were carried out by fluorometric real-time PCR using a 7500 fluorescence
detection system (Applied Biosystems, USA) and SYBR-Green PCR kits (Takara,
China). The qPCR thermal cycling conditions were as follows: 5 min at 95
°C, followed by 40 cycles of 15 s at 95 °C and 34 s at 60
°C. All samples were analyzed in triplicate, and the
2^−ΔΔCt method was used to analyze gene
expression levels. The fold change value was calculated for a gene expressed in
experimental vs control condition. Primers for specific genes are listed in
Table 1.

L'Huillier P.J., Soulier S., Stinnakre M.G., Lepourry L., Davis S.R., Mercier J.C, & Vilotte J.L. (1996). Efficient and specific ribozyme-mediated reduction of bovine alpha-lactalbumin expression in double transgenic mice.. Proceedings of the National Academy of Sciences of the United States of America, 93(13), 6698-6703.

+ Open protocol

+ Expand

Adipose and Pancreas RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Epididymal adipose and pancreas tissues were lysed in TRIzol reagent (Invitrogen, CA, USA), which was used to isolate total RNA from frozen tissues following the manufacturer's protocol. RNA quantity and quality were assessed using the NanoDrop ND-2000 spectrophotometer (NadroDrop Technologies, Wilmington, DE, USA). Single-stranded cDNA was synthesized using PrimeScript™ RT reagent Kit (Takara Bio INC., Shiga, Japan). Quantitative real-time PCR was conducted on a Rotor-Gene Q instrument system (Qiagen, Frederick, MD, USA) by using SYBR Green PCR kits (Takara). The relative mRNA level was quantified by the 2^−ΔΔCT method. PCR sequences for various genes are presented in Table S2. β-actin or Ppia was utilized as an internal control.

He M.Q., Wang J.Y., Wang Y., Sui J., Zhang M., Ding X., Zhao Y., Chen Z.Y., Ren X.X, & Shi B.Y. (2020). High-fat diet-induced adipose tissue expansion occurs prior to insulin resistance in C57BL/6J mice. Chronic Diseases and Translational Medicine, 6(3), 198-207.

+ Open protocol

+ Expand

Quantification of miRNA and mRNA Levels in SW1353 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of SW1353 cells was extracted for analyzing miRNA (Qiagen, U.S.A.) and mRNA (Axygen, U.S.A.) levels according to the manufacturer’s protocols. For quantification of miR-216b, the TaqMan MicroRNA Reverse Transcription Kit and TaqMan miRNA assay (Qiagen, U.S.A.) were used to perform reverse transcription and PCR according to the manufacturer’s instructions. U6 was used as the internal control. The gene expressions of PCNA, Smad3, MMP-13, aggrecan, and type II collagen were detected by using the SYBR Green PCR kits (TAKARA, Japan). β-Actin served as an internal control. The following primers were used: PCNA forward, 5′-CCTGCTGGGATATTAGCTCCA-3′, reverse, 5′-CAGCGGTAGGTGTCGAAGC′; Smad3 forward, 5′-CGGCTCTACTACATCGGAGG-3′, reverse, 5′-GTAGACAGCCTCAAAGCCCT-3′; MMP-13 forward, 5′-TGATGACATCAAGAAGGTGGTGAAG-3′, reverse, 5′-TCCTTGGAGGCCATGTGGGCCAT-3′; aggrecan forward, 5′-TGAGCGGCAGCACTTTGAC-3′, reverse, 5′-TGAGTACAGGAGGCTTGAGG-3′; type II collagen forward, 5′-AGAACTGGTGGAGCAGCAAGA-3′, reverse, 5′-AGCAGGCGTAGGAAGGTCAT-3′; β-actin forward, 5′-AGCGAGCATCCCCCAAAGTT-3′, reverse, 5′-GGGCACGAAGGCTCATCATT-3′; U6 forward, 5′-CGCTTCGGCAGCACATATAC-3′, reverse, 5′-AAATATGGAACGCTTCACGA-3′.

He J., Zhang J, & Wang D. (2017). Down-regulation of microRNA-216b inhibits IL-1β-induced chondrocyte injury by up-regulation of Smad3. Bioscience Reports, 37(2), BSR20160588.

+ Open protocol

+ Expand

Analysis of ErbB3 and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of tissues and cells was isolated by TRIzol reagent (Invitrogen) following the manufacturer’s protocol. The mRNA expression levels were detected by qRT-PCR. The complementary DNA (cDNA) was obtained by reverse transcription utilizing the miScript II RT Kit (TAKARA, Kusatsu, Japan). The SYBR Green PCR Kits (TAKARA) were employed to conduct quantitative PCR. Primers were synthetized by RiboBio (Guangzhou, P.R. China). The following primers were used: ErbB3, 5′-GGTGATGGGGAACCTTGAGAT-3′ (forward) and 5′-CTGTCACTTCTCGAATCCACTG-3′ (reverse); glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5′-ACAACTTTGGTATCGTGGAAGG-3′ (forward) and 5′-GCCATCACGCCACAGTTTC-3′ (reverse). Each sample was assessed in triplicate. The expression levels of mRNAs were normalized to levels of GAPDH, which acted as a housekeeping gene.
For the detection of human miRNAs, the TaqMan MicroRNA Reverse Transcription Kit and TaqMan miRNA assay (Qiagen, Hilden, Germany) were used to perform reverse transcription and PCR according to the manufacturer’s instructions. Reverse transcription was performed using the miScript II RT Kit (TAKARA), which was followed by qRT-PCR utilizing the miScript SYBR Green PCR Kit (TAKARA) and hsa-miR-125a-5p and hsa-miR-4319 specific primers that were purchased from RiboBio. The levels of miRNAs were normalized to levels of U6 small nuclear RNA (snRNA).

Li G., Zhang W., Gong L, & Huang X. (2019). MicroRNA 125a-5p Inhibits Cell Proliferation and Induces Apoptosis in Hepatitis B Virus-Related Hepatocellular Carcinoma by Downregulation of ErbB3. Oncology Research, 27(4), 449-458.

+ Open protocol

+ Expand

Quantification of ARHGAP24 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Trizol. Quantitative real-time PCR was performed using SYBR Green PCR kits (Takara, Japan). The following primers were used: ARHGAP24 forward 5′-AACTCCTGTCGCTCTTCTACC-3′ and reverse 5′-GCTGTTGCCCACAAATGTCTC-3′, GADPH forward 5′-CACCCACTCCTCCACCTTTG-3′ and reverse 5′-CACCCACTCCTCCACCTTTG-3′. Gene expression was normalized to GADPH.

Xu G., Lu X., Huang T, & Fan J. (2016). ARHGAP24 inhibits cell cycle progression, induces apoptosis and suppresses invasion in renal cell carcinoma. Oncotarget, 7(32), 51829-51839.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RT-PCR analysis, total RNA was isolated by using the TRIzol reagent (Takara Bio, Inc), and reverse transcription was performed using the PrimeScript RT reagent kit (Takara Bio, Inc) according to manufacturer’s instructions. The primers used in this study were shown as follow: GAPDH (forward sequence (F): 5′–GAAGGTGAAGGTCGGAGTC–3′ and reverse sequence (R): 5′–GAAGATGGTGATGGGATTTC–3′), IL-6 (F: 5′–ATGAACTCCTTCTCCACAAGC–3′ and R: 5–CTACATTTGCCGAAGAGCCCTCAGGCTGGACTG–3′), TNF-α (F:5′–ATGAGCACTGAAAGCATGATC–3′ and R:5′–TCACAGGGCAATGATCCCAAAGTAGACCTGCCC–3′), IL-1β (F: 5′–ATGATGGCTTATTACAGTGGCAA–3′ and R: 5′–GTCGGAGATTCGTAGCTGGA–3′), miR-124 (5′–GCGAGGATCTGTGAATGCCAAA–3′) and U6 (CD201-1045, Provided by Tiangen Biotech). GAPDH and U6 were used as negative control. The gene expression analysis was performed by quantitative real-time PCR (StepOne Plus; Applied Biosystems, USA) with standard SYBR-Green PCR kits (Takara Bio, Inc). Reactions were conducted by an initial incubation at 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The relative expression of each target gene normalized to GAPDH was calculated using the 2^−ΔΔct method.

Huang D., Li Z., Chen Y., Fan Y, & Yu T. (2021). Paeoniflorin reduces the inflammatory response of THP-1 cells by up‐regulating microRNA-124: Paeoniflorin reduces the inflammatory response of THP-1 cells through microRNA-124. Genes & Genomics, 43(6), 623-631.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells or tissues with TRIzol reagent (Omega, Norcross, GA, USA) according to the manufacturer’s instructions. RNA quality and quantity were assessed with the NanoDrop2000 platform (Thermo Fisher Scientific, Waltham, MA, USA). cDNA Synthesis kits (TaKaRa, Otsu, Japan) were used for mRNA reverse transcription. Real-time PCR analysis was performed with SYBR Green PCR Kits (TaKaRa) on the 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The amplified transcript levels of genes were normalized to β-actin with the optimized comparative 2^−ΔΔCt value method. The primer sequences are in Additional file 1: Table S1.

Hua Q., Wang D., Zhao L., Hong Z., Ni K., Shi Y., Liu Z, & Mi B. (2021). AL355338 acts as an oncogenic lncRNA by interacting with protein ENO1 to regulate EGFR/AKT pathway in NSCLC. Cancer Cell International, 21, 525.

+ Open protocol

+ Expand

Quantification of Gene Expression in A. limacinum

Check if the same lab product or an alternative is used in the 5 most similar protocols

A. limacinum OUC168 and the transformants were cultured in 250ml liquid medium at 23°C for 5 days. All the samples collected on first, second, third and fourth day at a confirmed time (13:00 o’clock) to eliminate the differences in gene expression levels due to circadian rhythms. RNA was extracted respectively using the Yeast RNAiso Kit (Takara, Japan).
Reverse transcription was performed to obtain cDNA using the RT reagent Kit and gDNA Eraser (Perfect Real Time) kit (Takara, Japan). Real-time PCR was performed with the obtained cDNA. The housekeeping gene 18Sr RNA of A. limacinum was used as a reference gene. The specific primer pairs (Table 2) were designed based on the sequences of two target genes (kr, dh) and the reference gene 18Sr RNA. Real-time fluorescence quantitative PCR (qRT-PCR) was performed on an ABI 7500 FAST real-time PCR platform (USA) using SYBR Green PCR kits (Takara, Japan) according to the manufacturer’s instructions.
The data were processed by Microsoft Excel. The relative quantities of gene transcripts for the samples were analyzed by the 2^−ΔΔCt method [27 (link)].

Liu Z., Zang X., Cao X., Wang Z., Liu C., Sun D., Guo Y., Zhang F., Yang Q., Hou P, & Pang C. (2018). Cloning of the pks3 gene of Aurantiochytrium limacinum and functional study of the 3-ketoacyl-ACP reductase and dehydratase enzyme domains. PLoS ONE, 13(12), e0208853.

+ Open protocol

+ Expand

Quantitative Analysis of HLA-A Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated from the rat heart tissue using the TRIZOL reagent (Thermo Fisher). A total RNA of 1 μg was used to reverse-transcribe to cDNA with the First-Strand cDNA Synthesis Kit (TAKARA Biomedical Technology), and Quantitative Reverse Transcription PCR was performed using the SYBR Green PCR Kits (TAKARA Biomedical Technology) on Bio-Rad CFX96 Real-Time System. The relative HLA-A gene expression was normalized to GAPDH. The primer sequences are as follows: human HLA-A (F: 5′-ATCATTGCTGGCCTGGTTCTC-3′; R: 5′-CACACAAGGCAGCTGTCTCAC-3′), GAPDH (F: 5′-TGACAACTCCCTCAAGATTGTCA-3′; R: 5′-GGCATGGACTGTGGTCATGA-3′).

Wu C., Zhou X.X., Li J.Z., Qiang H.F., Wang Y, & Li G. (2021). Pretreatment of cardiac progenitor cells with bradykinin attenuates H2O2-induced cell apoptosis and improves cardiac function in rats by regulating autophagy. Stem Cell Research & Therapy, 12, 437.

+ Open protocol

+ Expand

Immunohistochemical Analysis of SOX10

Check if the same lab product or an alternative is used in the 5 most similar protocols

The immunohistochemical antibody for SOX10 was procured from Fuzhou Maixin Biotechnology Development Co., Ltd. Other reagents such as TRIzol, Mir-X miRNA First-Strand Synthesis, and SYBR Green PCR kits were purchased from TAKARA in Japan. A 0.8 μm Transwell chamber was sourced from Corning (USA), and Matrigel was obtained from BD (USA). Monoclonal antibodies specific to E-cadherin, N-cadherin, and Vimentin were purchased from Wuhan Sanying Company in China. Fetal bovine serum (FBS) was acquired from Israel BI Company, and DMEM medium was supplied by Gibco (USA).

Yang K., Yun F., Shi L., Liu X, & Jia Y.F. (2023). SOX10 promotes the malignant biological behavior of basal-like breast cancer cells by regulating EMT process. Heliyon, 9(12), e23162.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!