The largest database of trusted experimental protocols

125 protocols using alhydrogel

1

Adjuvanted RG1-VLP Vaccine Formulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
RG1-VLPs were manufactured by Paragon Bioservices and were combined with Alhydrogel (InvivoGen, San Diego, CA) at 40 μg/ml RG1-VLPs and 1 mg/ml Alhydrogel and incubated on a rocking platform for 1 h at 4 °C with final dose of 2 μg RG1-VLPs and 50 μg Alhydrogel per injection before equilibration to ambient temperature and administration to mice. Stock solutions of PCMP and PCPP were prepared by dilution into ambient temperature 1X PBS, combined with RG1-VLPs, and vortexed 30 sec for final dosing of 2 μg RG1-VLPs and 25 or 50 μg PP adjuvant. Gardasil-9 (Merck, recombinant 9-valent HPV vaccine) was used as a positive control comparator at 2 μg HPV16-L1 VLPs per dose.
+ Open protocol
+ Expand
2

BALB/cJ Mouse Immunization with MT-001

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cohorts of 5–10 female, 8–10 week old BALB/cJ mice (The Jackson Laboratory, Bar Harbor, ME, USA) were immunized by injection into the gastrocnemius muscle with the indicated amount of MT-001 adjuvanted in 500 µg Alhydrogel® (InvivoGen, San Diego, CA, USA) in a final volume of 50 µL. Mice were boosted 21 days later with an injection of the same MT-001/Alhydrogel dose. Where indicated, 20 µg of CpG-ODN1826 (InvivoGen, San Diego, CA, USA) was added to the MT-001/Alhydrogel mix immediately before immunization. Pre-immune sera were collected 3 days prior to the initial immunization, and immune sera were collected after immunizations, as indicated in each figure.
+ Open protocol
+ Expand
3

Novel Oxy-TT Conjugate Vaccine Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Vaccines were formulated the day of immunization using 13:1:5 (v/v/v) mixture of Oxy-TT (1.0 mg/ml in PBS) or control TT (1.0 mg/ml in PBS), CpG ODN 1826 (5 mg/ml in PBS), and Alhydrogel® (alum, 10 mg/ml, InvivoGen). Rats were administered the conjugate vaccine (Oxy-TT; N=24) or tetanus toxoid only control (TT; N=24) on Weeks 0, 2, 4, 8 and 18 for Cohort 1 and on Weeks 0, 2, 4, 8 and 20 for Cohort 2 (Figure 1D). The immunization protocol was adapted from a vaccination protocol previously reported (Nguyen et al, 2016 (link); Nguyen et al, 2017a (link)). Vaccines were formulated the day of immunization using 13:1:5 (v/v/v) mixture of Oxy-TT (1.0 mg/ml in PBS) or control TT (1.0 mg/ml in PBS), CpG ODN 1826 (5 mg/ml in PBS), and Alhydrogel® (alum, 10 mg/ml, InvivoGen). CpG ODN 1826 is a phosphorothionated oligonucleotide and murine TLR9 agonist with the following sequence (5’ to 3’): TCCATGACGTTCCTGACGTT (Eurofins MWG Operon) (Bremer et al, 2014 (link)). Each vaccine was prepared by shaking the mixture for thirty minutes prior to injection. The delivered dose of each component was 200 μg Oxy-TT or TT, 150 μg of CpG ODN 1826, and 1.5 mg of alum per animal for each intraperitoneal injection (i.p.). Additional details can be found in the Supplemental Information.
+ Open protocol
+ Expand
4

Vaccine Adjuvant Formulations and Immunization

Check if the same lab product or an alternative is used in the 5 most similar protocols
For all Alhydrogel (Invivogen, San Diego, CA) formulations, a dose of 1 μg of each antigen was added to 1 mg/mL Alhydrogel, which contains a final dose of 500 μg aluminum hydroxide per injection, in Dulbecco’s Phosphate-Buffered Saline (DPBS), and incubated rotating for one hour at room temperature. For all AddaS03 (Invivogen) formulations, AddaS03 was added in a 1:1 volume to 1 μg of antigen for a final volume of 500 μL and mixed 10 times by pipetting. Between the time of formulation and injection into rabbits, all formulations were kept at room temperature. Rabbits were immunized subcutaneously in one site in the dorsal area with formulated vaccine as described above on day 0 and day 21. Rabbits immunized with Pfs230D1/AddaS03, ferritin/Alhydrogel, and ferritin/AddaS03 were bled for sera on days 0, 14, and 35 of the study. All other study groups were bled for sera on days 0, 14, 35, 63, 92, 119, and 147.
+ Open protocol
+ Expand
5

Vaccine Efficacy Against Trichinella britovi

Check if the same lab product or an alternative is used in the 5 most similar protocols
Eight-week old male C3H mice were divided into three groups of 12 animals each. The vaccine group was immunized subcutaneously with 25 μg of rTbCLP emulsified with the adjuvant Alhydrogel (InvivoGen) in a total volume of 100 μl (antigen/Alhydrogel = 75/25 v/v). The mice were boosted with the same dose after 1 week. The control groups were injected with PBS or PBS+Alhydrogel using the same regimen. 1 week after the final vaccination, six mice from each group were sacrificed, and their blood and spleens were harvested for immunological tests. The remaining six mice from each group were challenged orally with 500 T. britovi ML. 7 weeks (48 days) after infection, all mice were sacrificed, the blood and spleens were harvested, and the T. britovi muscle larvae were recovered by HCl-pepsin digestion. Protective immunity was calculated according to the number of ML recovered from the vaccinated group compared with those from the PBS group. Sera from all mouse blood samples were isolated and frozen at −20°C for further analysis.
+ Open protocol
+ Expand
6

Intranasal Challenge of Serogroup B Meningococcus

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 200 μl NOMV dose contained 2.5 μg of protein suspended in a solution of 3 mg/ml of aluminum hydroxide (Alhydrogel, Invivogen), 10 mM histidine (Sigma), and 150 mM NaCl (Sigma). A control vaccine containing aluminum hydroxide (Alhydrogel, Invivogen), 10 mM histidine and 150 mM NaCl (Sigma) was prepared without the addition of the NOMV.
On day 0, groups of mice (N=14 to 16), aged 6 to 8 weeks, were administered the NOMV vaccines or aluminum hydroxide by IP injection. The injections were repeated on days 14 and 28. On day 42, the animals were challenged intranasally with the wildtype serogroup B strain H44/76 (Figure 1). Three days later, the animals were sacrificed and nasotracheal washes were obtained for measurement of mucosal antibody and quantification of N. meningitidis CFU (See below).
+ Open protocol
+ Expand
7

Ovalbumin immunization in young and elderly mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the ovalbumin mouse study, 8-week (Young group) and 70-week-old (Elderly group) female C57BL6/J were ordered from Jackson Lab. After rest, each mouse was vaccinated subcutaneously in the back of neck at day 0 (Prime) and Day 14 (Boost) using a vaccine including 25 μg ovalbumin (Invivogen, France) and the indicated adjuvant (beQS-21 or ccQS-21: 5 μg/mouse, GPI-0100: 25 μg/mouse, Addavax: 50 μL/mouse, Alhydrogel: 50 μL/mouse, MPLA: 2 μg/mouse). beQS-21 or ccQS-21 were in-house products at Agenus/SaponiQx. GPI-0100 was from Hawaii Biotech (Hawaii, US). Addavax, Alhydrogel, and MPLA were from Invivogen. Plasma was collected at day 0, 14, 21, 28 for anti-ovalbumin IgG2c/IgG1/IgGs ELISA detection. Splenocytes were harvested at day 28 for Elispot and Luminex cytokines analysis after ex vivo restimulation. Draining lymph nodes and non-draining lymph nodes were also harvested and processed for downstream analysis.
+ Open protocol
+ Expand
8

Evaluating COBRA HA and N1-I NA Vaccines in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
All procedures were reviewed and approved by the University of Georgia Institutional Animal Care and Use Committee (IACUC). For the H1 HA study, 10 six-to-eight-week-old male and female BALB/c mice (Charles River Laboratories, Wilmington, MA, USA) per group were immunized subcutaneously with 20 μg of Y2 COBRA HA, CA09 HA, or phosphate-buffered saline (PBS) adjuvanted with AddaVax, AddaS03, CpG ODN 2395, and Alhydrogel (Invivogen, San Diego, CA, USA), or with PBS as a no adjuvant control. Mice were bled at 27 days post-prime for d27 serum, then immunized at 28 days post-prime with 20 μg of the antigen. At 56 days post-prime, animals were bled for d56 serum, and then euthanized with Avertin.
For the N1-I NA study, five six-to-eight-week-old female BALB/c mice (Charles River Laboratories, Wilmington, MA, USA) per group were immunized intramuscularly with 6 μg of N1-I COBRA HA or PBS adjuvanted with AddaVax, AddaS03, CpG ODN 2395, and Alhydrogel (Invivogen, San Diego, CA, USA), or with PBS as a no adjuvant control. Mice were bled at 27 days post-prime for d27 serum, then immunized at 28 days post-prime with 6 μg of the antigen. At 56 days post-prime, animals were bled for d56 serum, and then euthanized with Avertin.
+ Open protocol
+ Expand
9

Balb/c Mice Immunogenicity Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Six-week-old, female Balb/c mice were ordered from Janvier labs and acclimatized for 1 week. Immunogens were thawed on ice and diluted in PBS (pH 7.4) to a concentration of 0.2 mg/ml. The immunogens were then mixed with an equal volume of 2% Alhydrogel (Invivogen), resulting in a final Alhydrogel concentration of 1%. Other adjuvants were formulated according to manufacturer’s instructions. After mixing immunogens and adjuvants for 1 hour at 4°C, each mouse was injected with 100 μl, corresponding to 10 μg immunogen adsorbed to Alhydrogel. All immunizations were done subcutaneously, with no visible irritation around the injection site. Immunizations were performed on days 0, 21, and 42. Blood (100–200 μl) was drawn on days 0, 14, and 35, and the maximum amount of blood (200–1,000 μl) was taken by cardiac puncture at day 56, when mice were euthanized.
+ Open protocol
+ Expand
10

Immunogenicity Evaluation of Chimeric Antigens

Check if the same lab product or an alternative is used in the 5 most similar protocols
In the first immunogenicity study, groups of six female CD-1 mice (Janvier Labs, Denmark) were immunized s.c. 3 times at three-week interval with 10 µg of chimeric antigens on 70% Montanide ISA720 (Seppic, France). Mice were sacrificed two weeks after the last immunization and serum was collected for ELISA and SMFA analysis. In the second study, groups of five female CD-1 mice (Charles River, Germany) were immunized i.m. in the right thigh with 50 µl of vaccine (ProC6C), two times with a four-week interval containing 0.4 or 2.0 µg of ProC6C. Alhydrogel (InvivoGen, USA) formulations contained 75 micrograms of Alhydrogel and were mixed by pipetting for 5 min. Matrix-M™ adjuvant (Novavax AB, Uppsala, Sweden) formulations contained 5 micrograms of Matrix-M adjuvant per injection and were mixed by pipetting shortly. Formulations that contained both Alhydrogel and Matrix-M adjuvant were prepared by first adsorbing ProC6C to Alhydrogel as described above and then adding Matrix-M adjuvant. Fourteen days after the last immunization, mice were sacrificed, and serum was collected for ELISA and SMFA analysis.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!