The ATM, FOXO3a, P65 (RELA), TNF-α and PINK1 genes were investigated by quantitative real-time PCR (qPCR) using the Syber Green kit, according to the manufacturer’s protocol. Among genes involved in cellular senescence and mitophagy, this set of genes was selected after exploring gene expression data generated by the GTEx (Genotype-Tissue Expression) database. These genes are expressed in human skin cells and showed no differences between sun-exposed and non-sun-exposed skin areas. Specific primers were used. The qPCR reaction was carried out in a 96-well plate using the Light Cycler L480 (Roche Applied System) with a reaction volume containing Sybr Green Mix (Invitrogen), Quantities of 10 µM of each forward and reverse primer for 17 µL of Mix and 100 ng/µL of cDNA were used. cDNA amplification was performed in a cycling protocol with 35 cycles (at 95 °C for 15 s and for 60 °C for 1 min) preceded by a pre-amplification step at 95 °C for 10 min. Relative gene expression levels were normalized to the expression of the housekeeping gene RPLP0. Experiments were performedin duplicate for each candidate target gene and for each reference gene. Relative fold changes were calculated using the comparative cycle threshold (ct) method (2−ΔΔCt). The sequences of the primers are listed in Table 3 .
Sybr green mix
Manufactured by Thermo Fisher Scientific
Sourced in United States, Switzerland, Germany, United Kingdom, France, Belgium, China
SYBR Green mix is a reagent used in real-time PCR (qPCR) experiments. It is a fluorescent dye that binds to double-stranded DNA, allowing for the monitoring and quantification of DNA amplification during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (140 mentions)
Trizol, by Thermo Fisher Scientific (43 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (21 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (21 mentions)
Rneasy mini kit, by Qiagen (20 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (15 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (12 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (11 mentions)
M mlv reverse transcriptase, by Promega (10 mentions)
Dnase 1, by Thermo Fisher Scientific (9 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (9 mentions)
Lightcycler 480 2, by Roche (9 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (9 mentions)
Reverse transcription kit, by Takara Bio (9 mentions)
Superscript 3, by Thermo Fisher Scientific (8 mentions)
Rneasy kit, by Qiagen (8 mentions)
Nanodrop, by Thermo Fisher Scientific (8 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (7 mentions)
Primescript rt reagent kit, by Takara Bio (7 mentions)
Primescript rt master mix, by Takara Bio (6 mentions)
375 protocols using sybr green mix
1
Quantitative PCR Analysis of Cellular Senescence and Mitophagy Genes
2
Comprehensive Protocols for Amphioxus and Xenopus Developmental Studies
3
Quantitative RT-PCR for Axon Guidance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On days 13, 15, and 17 of gestation, 4 animals randomly selected from each group were deeply anesthetized with pentobarbital sodium and then the collection of AF and the extraction of total RNA was performed in the same way as described in microarray part. The expression of representative microRNAs and their predicted targets in axon guidance pathway were determined by two steps of quantitative RT-PCR. First, the cDNA of microRNAs was synthesized with specific reverse-transcriptional primers (S1 Table ) and the cDNAs of mRNAs were synthesized with oligo(dT). Then PCR reactions containing SYBR Green Mix (Invitrogen, Carlsbad, CA) were performed on a CFX96 system (Bio-Rad, Hercules, CA) with specific amplification primers (S2 Table ). The relative microRNA and mRNA levels were computed using the 2-ΔΔCt method, where Snord2 and NADPH were used as internal controls for microRNA and mRNA, respectively. All reactions were run in triplicate.
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (Invitrogen, Karlsruhe, Germany) from two cell lines. Quantitative real-time PCR was performed using a SYBR Green mix (Invitrogen) and run in an ABI 7500 real-time PCR system (Applied Biosystems) with cycling parameters listed as follows: 94°C for 2 min followed by 40 cycles of 94°C for 15 s, 56°C for 20 s, and 72°C for 30 s and then followed by 72°C for 2 min. With a melting curve analysis, ΔΔCT was used to calculate the relative gene expression of qPCR. Primers detected in the study are as follows: GAPDH forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′, reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′; MCL1 forward, 5′-GGCCTTCCAAGGATGGGTTT-3′, reverse, 5′-ACTCCAGCAACACCTGCAAAA-3′; BCL2 forward, 5′-GGTGGGGTCATGTGTGTGG-3′, reverse, 5′-CGGTTCAGGTACVTCAGTCATCC-3′; ICAM-1 forward, 5′-ATGCCCAGACATCTGTGTCC-3′, reverse, 5′-GGGGTCTCTATGCCCAACAA-3′; ADH1B forward, 5′-ATTGGCTGTGGATTCTCGAC-3′, reverse 5′-ATTCAGTGGCACCCAACTCT-3′; VEGFA forward, 5′-TGTGTGGGTGAGTGAGTGTG-3′, reverse, 5′-TATTGGAATCCTGGAGTGACC-3′. Three independent experiments were performed for all assays.
5
HepG2 Cell RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HepG2 cells were harvested to extract total RNA using Trizol reagent, following culture in a six-well plate and PBS washing two times. Reverse transcription was conducted using the RT-MIX to obtain cDNA. RT-qPCR amplification was performed with the SYBR GREEN MIX (4309155, Invitrogen, Waltham, MA, USA). RT-qPCR cycle conditions: 95 °C, 2 min; 95 °C, 15 s; 60 °C, 60 s; there were 40 cycles. Detailed primer sequences are listed in Table 1 . RNA expression level was normalized to actin.
6
Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 50 mg sWAT using Trizol reagent (Invitrogen, CA, USA). RNA quantity was determined using Nanovue (GE Life Sciences) spectroscopy, and 1 mg RNA was treated with DNAse I (Invitrogen). First-strand cDNA synthesis was performed using Oligo (dT) primers for mRNA and Superscript III reverse-transcriptase (both Invitrogen). Quantitative real-time PCR (RT-qPCR) was performed using a StepOne plus cycler and the SYBR Green mix (Invitrogen). Primers were designed using Primer3web online software version 4.0.0 and are indicated in Table 1 . The beta-actin gene was used as an endogenous control to normalize selected gene expression. Efficiencies of RT-qPCR for the target gene and the endogenous control were approximately equal and were calculated from a cDNA dilution series. Real-time PCR reactions were conducted as previously detailed [12 (link)]. Negative controls consisted of wells in which cDNA was substituted for deionized water. The relative mRNA expression ratio (RQ) was calculated using the 2-∆∆ct equation in which 2∆CT expresses the difference between the number of cycles (CT) of the target genes and the endogenous control.
7
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (Invitrogen, Germany) from two cell lines. RT-qPCR was performed using SYBR green mix (Invitrogen, Germany) and run in the 7500 Real-Time PCR Systems (Applied Biosystems, USA) with cycling parameters listed as follows: 94°C for 2 min followed by 40 cycles of 94°C for 15 s, 56°C at 20 s, and 72°C at 30 s and then followed by 72°C for 2 min. With a melting curve analysis, 2−ΔΔCT was used to calculate the relative gene expression of RT-qPCR. Primers detected in the study were listed as follows: miR-193a-5p forward: CTGGGTCTTTGCGGGCGAG; reverse: GAATACCTCGGACCCTGC. miR-193a-5p RT primer: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTCATCTCG. U6 forward: CTCGCTTCGGCAGCACA; reverse: AACGCTTCACGAATTTGCGT. U6 RT-Primer: AACGCTTCACGAATTTGCGT. GAPDH forward: GGAGCGAGATCCCTCCAAAAT; reverse: GGCTGTTGTCATACTTCTCATGG. CUX1 forward: GAAGAACCAAGCCGAAACCAT; reverse: AGGCTCTGAACCTTATGCTCA. ITSN1 forward: ATTTATCCTGGCAATGCACCTC; reverse: TCCCGCTTCTTATCTTCAAACG.
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNeasy columns (Qiagen), and cDNA was reverse transcribed from 2 μg RNA using Applied Biosystems technology (Invitrogen) (AB 4368814). Quantitative real-time RT-PCR (qRT-PCR) was performed in triplicate using SYBR Green mix (Invitrogen 4309155) on SDS7900HT FAST detection system (Applied Biosystems). For the primer sequence refer to Table S1 in Additional file 1 . Samples underwent three-step amplification at 94°C (1 min), 60°C (30 sec), 72°C (30 sec). Melting curves were analysed after 40 cycles. The Ct values for test genes were normalized to ACTB and relative expression represented as 2-ΔΔCt. To measure microRNA (miRNA) 200c expression levels, total RNA extracted was used to perform RT-qPCR using Taqman mature miRNA primers and probes (Applied Biosystems). Briefly, mature miRNA expression was measured using stem-loop reverse transcriptase primers for miRNA cDNA synthesis followed by Taqman PCR analysis. RNA was reverse transcribed followed by qPCR on a 7900 HT Fast Real-Time PCR System (Applied Biosystems). Duplicate samples and an endogenous control (small nuclear RNA (snRNA) U6) were used throughout. Expression levels of each miRNA were evaluated using comparative threshold cycle (Ct) method using the 2-ΔΔCt method with normalization to U6.
9
Quantifying Cellular Markers in Mouse Tissues
10
Extraction and Quantification of Mammalian RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The GeneElute Mammalian Total RNA Miniprep Kit (Sigma) was used to extract RNAs, following the manufacturer’s protocol. Briefly, 1 μg of RNAs was retrotranscribed using the SuperScriptTM III First-Strand Synthesis SuperMix Kit (Invitrogen) and diluted in DEPC water. Primers (Supplementary Table S1 ) for RT-qPCR were designed using Primer 3 (http://frodo.wi.mit.edu/primer3/ ) and tested for their efficiency. RT-qPCR was performed, according to the SYBR Green Mix (Invitrogen) protocol, on real-time system Realplex2 Master Cycler (Eppendorf) or on ViiA7 Real-Time PCR system (Invitrogen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!